Description :
From Genome Similarity Track
Location :
contig_120:58501- 61903
Transcript NameFunction/comments
g13937.t1RAW27449.1 hypothetical protein PC110_g16154 [Phytophthora cactorum
g13938.t1XP_009533075.1 hypothetical protein PHYSODRAFT_517932 [Phytophthora sojae

Sequence
3402 bases(100 bases per row)
CGCCATGGCGCGCAAGCCTGCCTTCACGATGGAGGACGCCAAGGCGGCCTTCAACCTCTTCTGCTGCGTTTACGGCATTGGAACGCTTGGTATGCCCGGC
AACTTCTCTCGTGCCGGCCCCGTCATCGCCGTCATCGCCATGGCCTTCATGGCCTTCGCCAACACGTACTCCTCCGTGGCTATCTGCCGCGTCATGCTGC
TCGCTCCCCGTTCCGTCAAAACCTACGGTGACCTTGGCGAGTGGTGCATGGGCAAGACCGGTCGCTACCTGTGCGTCATCTCTCAAATGGGCAACTGCCT
GCTCGTCCCTTGCGTCTTCCTCGTGCTCGGTGGCACTCTGCTCGACGGCCTCTTCCCGGAGGCTTTCAGCCCCTCGACGTGGATCATCCTCATGGCGGTC
ACGTGTCTGCCGGTGTGTCTGGTGCCAACTCTCAAGGAGGAGCTGGTGCTGCCTTTGCGGGTTGCATGGGCACGCTCATCGCTGATATTATCGGCGTCTC
GGTCGTGATGTACGGCATGCGCGGTCACCCCAGCGTGCCGAAGCCCGACCTCGCCTTCAAGCAAGTGGCTGGTGCTTTCGGCAACCTGGCGCTCGCGTAC
GGAGCCGGTATCGTGATTCCGGCGCTGCAACGCCAGCACAGTGACCCCACGCGCATGCCCCGTGTTGTTGGTGCCACGATCGCGTTCATCTCGTGCTGCT
TCCTGGTTCTGGCTAGTACTGCGTACTCGTCCGTCGGCTGCCAGATCTCGGGCAACTTGCTGTGGTCGATCTACCCGGACACGGAGACTGGCCTGACCAC
GCTGGGCTTCGCGTCCGACTGGGGTGCCGTCGTCCTCGCGTACCTCTTCATGCAGCTCCACATTACGATCGCCTTCTCTGTCATCCTGAACCCGGCCTTC
TACATTTGTGAACGTATCGTGCTCGGCATGCACAAGCAAAGTGCGGATGATATCGAGAACAACCTTATGAGCTACGCTGATGCAGCCACACCCGCAGACG
TTGCTGAACATTCGGAGAAGGAGTCCCGTGCTTCCAAGCGTTCGTTCATTTCGGTGGCTGATAACGAGAACGTGCACCTTGGAGACGACGAGTCCGAGGC
TGCCGAGTATCGCGGCGCGAACGCTATCAAGTATGTCATTCTTCGCATTGTAATCATTGTGATTCTCGTCATTGCGTCGGTGCTGCTGAAGGACCATTTC
TCGGACCTGGCGGACTTTGTCGGCTCGTCGTGCATCACAGTGAACTCCATTCTCTTGCCCATCGTTTTCCTGCTCAAGAAAAAGTGGGGTGTTCTTCCAA
TGTGGGAGAAGCTTCCAGCCCTGACGGTGGTCGTGGTGTGCTTCTGCCTGGGCTGCTACGTGACATACACGTCGGGCAAGAACCTGTTTGCCCCCAGCGA
CGACGAGACGTCCTTCCCGTTCTGCGCGCCCGAGTACGAGAACACCGTGTACTACAACTACACGGCTGCTCACGAGAACTAAGCGCTGGTCTGAACTTGA
GATTGTTGTCGCGTGAAGCTGTCAGTAGACTATACCAATACACAACGTTTGCTTTCTACTACGTCAATAATTTGATTAGACCCCCTTTACAGCTATTATA
GAACAACAGGACCACTAAGGAGATCAGCATTATGCACGATCACCTCCCAGCCTTGTCGTTTACGATGAAACAGGACTACTTAAATAGTAGGGATAGTGTG
TGACCAGGACGCCACCGTCAAGCTACCCACCCTACCACATGTGACTTTCAAGACAGCGAGCTCGTGCCACTGAATGAGCGTAAAAAAAAAACAGATCGGT
TTTCGATTTCGTTTACATCAACCGAAAAACGGCAACACTTCGTTCACCTAGCTTAACTCTCGTGCACGGCAGTGTAGTTGTAGTAGACAGTATTCTCGAA
CTCGGGCGCACAAAACGGGAAGTCCCTGTCATCCTCGGTAGGAGCAAATAGGTTCTTGCCCGACGTATACGTTACGTAGCAGCCCAGACAGAAGCACACC
ACGATCACGATAAGCGCCGGGATCTTCTCCCACATCGGTAGCACGTTCCACCTCTTCTTCAGCAGGAAAACAATCGGCAAGAGGATCGAGTTCACCGTGA
TACACGACGCACCCGCGAAATCGGCCAGGTCGTGGAAGTGGTCCTTCAGGAGCACCGATGCGACCACCAAGAGTGCGATCATGATGATCCGCAGAACCAC
GTACTTGATGGCATTCGCGCCGCGGTACTCGGCAGCCTCGGCCTCGTCGTTGCCGAGGTGCACGTTCTCGTTGTCGGCAACGGAGATGAAGGAGCGACGC
TTGGAGGCACGTGACACGTGCGACTGCTTCTCCGAGCGCTCGACATCAGCGGGTGTAGCAGCATCGGCATAGTTCAGAAGGTTGTTCTCGACGTCATCGA
CGATGGGCTTGTGCATGCCAAGGATAATACGTTCCGCGATGTAGAAGGCCGGGTTCAGGATGACAGAGAAGGCGATCGTAATGTGGAGCTGCATGAAGAG
GTACGCGAGGACGACGGCACCCCAGTCGGACGCGAAGCCCAGCGTGGTCAGGCCAGTCTCCGTGTCCGGGTAGATCGACCACAGCAAGTTGCCCGAGATC
TGGCAGCCGACGGACGAGTACGCAGTACTAGCCAGAACCAGGAAGCAGCACGAGATGAACGTCATGGTGACACCAACAACACGGGGCATGCGCGTGGGGT
CACTGTGCTGGCGCTGCAGCGCCGGAATCACGATACCGGCTCCGTACGCGAGCGCCAGGTTGCCGAAAGCACCAGCCACTTGCTTGAAGGTGAGGTCGGG
CTTCGGGATGGTCGGGTGGCCACGCATGCCGTACATGACAACTGCGACGCCGATGACGTCCGTGATGATGGTGCCCAGGCAACCGGCGAAAGCAGCACCA
GCTCCCTCCTTGAGAGTTGGCACCAGACACACCGGCAGACACGTAAGCGCCATGAGGATGATCCACGTCGTCGTACTGAAGGCTCCCGGGAAGAGGCCGT
CCAGTAGCTGACCGCCGAGCACGAGGAAGACGCAAGGGACGAGCAGGCAGTTGGCCATCTGCGAGACGACCGAGAGGTAGCGGCCCGGCTTGCCCATGGC
CCACTGACCCAGGTCGCCGTAGGTCTTGACGGAACGGGGAGCGAGCAACATGACGCGACAGATAGCCACCGCGCCGTAGACGTTGGCGAAGGCCATAAAA
CCCATGGCGATGACGGCAAGCACGGGGCCGGCACGAGAGAAGTTGCCGGGCATACCAAGCGTTCCAATGCCGTAGACGCAGCAGAAGAGATTGAAAGCCG
CCTTGGCGTCCTCCATCGTGAAGAAAGCTTTGCGTGCCATGGTAGGGGCAGTGAAGGCAGGCGCGGGCGGAGGGCAGTCGGCTTGGGTAGTTGATGAGGT
GG