Description :
From Genome Similarity Track
Location :
Scaffold_393:585- 3376
Sequence
2791 bases(100 bases per row)
cgttctactatagtagtatcagtgatattggattagagtccgttagtagtagtagtatcactactaacccaaaattctctctacttccgaaccgtgGCTG
TGATGTCCTGAGCATGTTGCTTGCCTCCAAGGCGGGCAGGCAGGTGCCGCTGTTGCGGATAATATCCCAGGGATATAGTTCAGCTTATCCTCGTAAGCGT
TATTCGAGGCTTCTTCTCACGAGATCATTCGAGGTGGTGGTCTGCCAACTTTGTAGATGAGCCAAGTCTCAATTGGCTGGTTGCTGCGCATCGAATCACC
GCGAGGGATTCGTAACGCAGATATCGAAGTATTATAGTATGCGATATCGCAGATCACGTTATATCGTAATATATTAAAACCTATATTAATAATATGCATT
ACTATTTATCATTAAGTACGATTGAAGCAATTCCAATTCTATGGGACGTGGTAGTTAGACAGTATTCAAGGTACGCTACGAGCAAAAGAGTCTCAGAGCG
ATTTCCGCAACTCTGTGCTTGTATTACGAGTTACTGACATGGAAGTTGAACGTACCGCTGGCCTTCATCACTTCTGAATTGCTGGCGAATTCTATAAATT
AGTGAGTGAAAGTATGCATGCATGAATATATGATagagatttcggaacccacacaccaggcttgaggcttgctctggtggggatgcctgtggctatccga
cccatttcgggacgggattccgatacccctcattacttggggcctccagcctacccaactaccctacaccggggtgcggattggcacggagtggctgctc
gATGAATGTATGATAGAGCAAACGGGCAAGCTATCCCAGTGTATCGCTCACAGCACAACAAGTGGTAGAAACACTCTTTTTGGTGTGACATAGTTCTTCT
TACGTCAAGTGGCTACCACTTCCAAATGTCGCTTTCCAATCTTCCTCAAGTAACAGCTCGCGGATCAATTCGCAGTAAAGGATATTCGTAATCTTCTGAG
CTCTCTCCATCGAGTCAACGAGCGCGCGGATCTGCCAGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN