Description :
From Genome Similarity Track
Location :
scaffold_1:58472- 60312
Sequence
1840 bases(100 bases per row)
GATGGAAAGGTATAATGAACAGTCCTAGGGCGTTCTATGGACAAACTCCGTGTATGAACTTGTCAAGAAATATGCTGATATATCCCAGACAAGGTGTCAA
ACGAATTGTCATCTGCCAGAGGcattcgtcatgagattgacatacATCCAGAAATAAAGCATTGTATCACACGGCGGTTGTCGTTGCCAAAAAAATAATT
CATTGCAATCAACGAGTTCTTTGCACAGCGTAAGAAGGCTGGTCATGTGCTGGAGAGCAAGACTTTGCATTGCAGCCCAACCATCTGTGTGTAGAGAGCC
ACAGGAGGTTGGCGAATCGTTTACAAATTAAACGGTACAACCATCCTGCCCAGACTCCGGTTTCGCGCAAAAATTTGATCCTCGATGGAATGATGTACAG
TGCTGTTTTTGGTGCGATTAATCTGGTTAGTACTTTCATCAGATACGAATGCGCGAAAATAATACACCATGAACTGCAACAAATACTTCcagtggtatgc
tgtggGTTGATTAGTGATGCCATAAGATTTGAAGAACGCCCTCGCAACTTTCAACAGAATGGTCACGAATCTACTTCGTCCATTGGAAGAGTTTCCCCGA
GCTACTTCGACCATATGTATGTTTATAGTTAGAAAACAAAAGAGAAGTCTGATCtcgatgttcatcttgatcatggTCAAGTTCTTCCAGTTGTGCGAGA
GATTAAACCGTAAGCTAAACTGAAACAGTACGTTTTTCTTCCACCGAAGATCCCCGTTCTCGCTGCTTTCTGGGCAAGAATAACATTTGTATGGATTCGG
AGAAAGTCAAAGCAATCAATGATTGGCCTGTGTCAAACAACTGAGACGATGATTGGGCTTAGCCAATTATTTACACAAACAGACGCGCAATTATGCAGCG
TTAGTACAATTCCTGACGacttttttaaaaagaaaattgaGTTCGAATGGTCAGAGGATCACCATGCGGTATATGCCGAAGTAAAAATGATCTTGTGAGA
ATCTCCAGCGCTTGCGATTGCAAAGCACGTATAGCCTTTTAAATTGGTGTGTGATGCAATTGATTATGCCATCGGTTGAGCGTTGATGCAACATGATGAT
AAGGGTCAAGAGAGCGAGTTGTTTCATATTAGTCGCGACAATATCAGAAATTATTCAATTCATGACAAAGAATCTATAGCAGTGATGTATGCTTTGGGTA
AGTTTCATGTGTACTTGCTTGGAGAGGAGCACATTGCGATCTATATAGATCATGCCCTACTGCGTACGGCAGTAAAAACCCTCATTTTTTGCGAATTATG
GCTCGATGGCTTTCCTTTTTTGCGATGTTTAATTTGGTTATATACCACAAGCCAGACTGTACGAGCACCGTTACCGATGCGTTATCAGGATGTCAGGACT
ATTATTTAAAGTCCAGGAGCGAAAACATGCACGAGTCGTGTCGACAATGCGAAGATGTTCAGACGATCAGAGTGCAAGCAACGATTATAGTGCGCGAAGA
AGTTGTCAAAGGGTACAAGTCTTAGCAGGACATGTTGAgatatttcaaaaaatacttccgacaaagcactgcaagaTCTTCCGACTCGCACAAGATCACG
TGTTCAACCTTGTGAGTACACAATAGATTGTTGTACTATGCGGCTGTAACGGGGGTACATCAAGAGTTGTTGTtccaaaaatgaaaatttgCGTCATCGT
CTCTTACATGTGTACCATGACATGTCCATCTGGGACGTGGGAAAACATATCTCATTCTTTCCCGAGATTACTATTAGTCACAGATGCAAAGGTGGGTGCG
CAAATATGTTAGGACTTGTGAAATTTGCTAGAGTGAAACC