Description :
From Genome Similarity Track
Location :
contig_41:58466- 61397
Transcript NameFunction/comments
g8853.t1hypothetical protein

Sequence
2931 bases(100 bases per row)
GTGGTGCCCTGTCCTGCTGGACTCGGGCGTGTCTCACCACCTGACGGGCCGACTGGAAGACCTCGTGGCCACCCACACGAGCCCCGCGCTCGCAATCAAG
GTTGCCGACGGTCGCACGGTTGTCTCTCAAGTCAAGGGAAGGATGATGATCCAGGCGATAGTAGACGATGGAAAAGGAGGAGTCTCCACGCGGGAGTTCG
TACTTGAAAATGTCTACTACGTGCCAAAATTTCCCAAGACTTTGCTTTCAATCTCGACCCTGGTTCGTACCGGACATGACGTGGAGTTCACGCCTCGTGG
ATGCACGGTTTTTCGAGGAAATCGTAGACGTGTGGGGTGTATTTCGCGCGTAGAAGACGGAGTGTATCCCGTGCTCACTCCGGAGAGCTTGCTGGGATCT
GCCAGCGTCGCCATGTCGTCCGCGTTCGCAGTGCTGGGACGCGATCTCGAGACCTGGCATCGACGCATGGGGCACATGAACTACAAGACGCTCAAGTGGA
TGGCCGCAAACAAGATCATTAGAGGACTGAACATCCAGCCTGGAGCAAAGCCGCCTGTGTGTGTAGTGTGCGCACTCACCAAGTCTCTACAACACGCGCC
GCCAGCGGAGCGAACGAGCAGTGACGAGTTCCAGGATGGCGTCGTGCACGCAGACCTCAGTGGACCACTGGCAAAGACGCGTGGTGGCCACCGGTACTTC
ATGGTTGTGATCTGGCGCGGCTTCCTTCAAGTGTATCTACTCAAGAAGAAGAGCGAGGTAACAGCAAAAGTCCGAGCATTCTTGAAGCTAATCGAGCGCC
AGGCCGAAGTACCAGCAACCGACATCAAGGTCATACGGACAGACGGCGGGACGGAGTTCCTCAACAAGGATTTTCGTCGGCTGGTCCAGCAAGAAGGCCT
GTGGCAAGAACACACGACGCGCTACAGTTCTTTCCAGAACGGCGTCGCTGAACGGGCCATCCGGTCAGTCACGGAGATGGCGTCCGCCATTCTCACAGAT
TCGGGATTGCTACATCAGATGTGGGGAGATGCGCTGAAGCATGCAGCGTTCCTGCGCAACAGGATCCCTCGCCGAGGGGAGACTGTGAGCCCATTCGAGA
AAATATTCAAGAGAAAACCAGACGTCAGCAAGGTGCCAATATTTGGACAAGCTTTGTCCGTTCGTGTCCCTGATGAGATTCGGATCAAGTACCAGCGGTT
CTCCAACACGCGGGGCCAGCTTGGTGCGTTCGTCGGTTGCACGGATGAAGTAAAGGGATACCAGGTCTATTTGCCAGGCCCAGGTCACCCAGTCTTTGAG
GCTCACAGCGCTACACTGATTGATCGAATGTACCACGAGCTGGAGGACGTCGGCGACGACGACCCCGACGACTTTGCTCCGGATAGCAGTGACGAACGTG
ACGATCAAGATCAGCAAGCAAACAATTCAGACAATGAGGCTCCGCATGAGTCGCAGTCTACGGCAAAGCGCCGCTCCCGTCGCATCGCGGCCCAAACATC
CTTCGCTGCCGTCGCTTTTGTGGTTCTGGGGGAGGTTCTCCGTGAGCCTCTAAATCTCCAAGATTACCTCAGTGGGCTGAGTGGCGTCAAGCCATCGAGA
AAGAATCAAGGCCCTGTTCGAAAATGGTACATTTGAGTGGGTGGATTTGCCTCCCGGCGCGTCAGTGCTTGACCACACGCTCCAATTTCGCGTGAAAACT
GGTGCTAATGGAGAGGTGATCCAGTTCAAAGCCAGGCTGTGTGCCCGGGGTGTGATCGACAGCAGTACATGCTCGACTTTCTGGACACCTACGCGCCTGT
GGCGGCTCTGACGACTGTGCGCATCTTCTTCGTGATCGTTGCCAAGCTGCGACTTGTGGTTCGTCAAGCCGACGTGCCCGCAGCGTATGTCAAGGCAGAT
CTCCTGGAGGAAATCTACATGCGCCCAGTCCCTGGATTCGGGACGCCAGAGCAGCGTGGAAAGGTGTGGAGGCTTCGAAAAGCCCTGTACGGGCTCCGAC
AGGCAGGTCGCGAGTGGAACAAAGCTATCGACGCGTTTCTCAAGGAATATGGGCTGGTGCCCACGGAAGCTGATCCCTGCTTATATTTCATGTACATTGA
TGACTCACTTCTCTTGGTGTGCCTGTATGTAGACGATTTGCTAGTGGCGCATGCCAACGAGGAGCAAGTGTTGCACCTGATGGTGGCACTCAGTCTCAAG
TTCGATGTGAAGGACATGGGTACACCCAGTCAATTCCTCGGCATGTGTGTGGAGCGTCCGAGCCCGTCGATCGTGTTGCTATCACAAGCCTCGTACGTGG
ACGAGGTGTTGCACCGCTTTGCGATGGACGGGGCGCGCCCGACCAAGACACCGATGGTCCCCGGCACTCGGCTGGACTTGATGGGTGGTGTGGTTCCTGA
AGATGAAGCCGTCATGATGAAGAGGATGCCGTATCGGGAAGGTGTCGGAGCGCTTCTTTATCTGGCTCGAGTGACAAGGCCGGATACCAGCTTCGCAGTT
GGACAGCTTGCAAGACATAACGCGCGTCCCAGGAAGGTCGCTTGGGATGCGGCGAAGTACCTCATGAGGTACTTGGCTGGCACGAGAAATATGCAGTTGA
CATTAGAGCCGACCGGTGAGGACATTACCGTAGCCTCCGACGCTGACTGGGCGAATGACCAAGTGGACCGCAAGTCAATTTCGGGCCGCGTTGTGTTTCT
CTTCGGGTGCCCAGTTGCTTGGGCTAGCAAGAAGCAGACTATTGTGACGAAGTCGAGTACTGCCGCGGAGTATGTGGCTGCAGATGACGCCATTGAAGAT
GCCGAGCTGGTGCAGTTGATCGTCGAGCAAGTCCTGCGGAAAAGGGTACCGCTTGTGCTCGCGATGGACAGCCAACCTGCCATTGCTCGTCTCAAACGCC
AAGGACTCAGCGAGAAATCGAAGACGGTGGA