Description :
From Genome Similarity Track
Location :
scaffold_41:58424- 60778
Transcript NameFunction/comments
g1825.t1 conserved hypothetical protein
g1826.t1hypothetical protein

Sequence
2354 bases(100 bases per row)
CGGAAATGGACACGCCGCCGAGCATCCGCCAGCAGTATGCGTCACCTCCGCGCGAGTCGCCGGAGGAGCGTCGGCGCCGGCAAACCAACCGGCGCGCTGC
TAAGTACCGCCACTTCAAGTTGATGTCCAGCGCGCAGAACGACGCTAGTGCGGCAGCCGAGCTCCAGCGGCAACAGAACACACGCCGGCAGCGCGAGCGC
CGTTCGCTGCTGGACGACGAGGCGCGCGATCGACTGCGCGCGCAGAACCGACAGCGGCAGCAGCTCCGACGCCAGAGCCTGAGCGACCGGGCCAAGGCCG
AAATCCGCGCGAAGCAGCGCGTGCGTCAACGCGAACGGCGACAGATGCTGGACGCCGACGCGCGCGAGGAGCTACGGGAGCGCGAGCGCCTGCGCGTCCG
ACGGCGGCGCCGACAGCAACTTAAAGTGACTAAAAGACAGAGACAGGTTGAAGAGGAGTCAGTGCTGCTGCCGGCACAGCTGCAGCTGCAGTTGCTGCAT
CCTCCAGTGGCCGACAGGGATCGCCTGGCGCACTTAAGACTGGCGCCGGAACTGCCAACGCTCCGGCAGCACCAGGAACAGCAGAGACAAGTCCACAACA
GGCTTCCATTTGGAGGCGGCGTGCAGATCACGCTACCACCGCCGCCGCCTCTGACCTTCCAGCACGAACGGATCCCGTCGCTGCCTCATTTGCAGCAGGT
GACGAGGCCTTCGGCGCCCTCGTTGCTGCATTCGACGCCACCGCCGTTATTCACTATGCCCGGGCCGCTTGGTACGTCCAATGCAAGTCAGGTAGGCTCT
GCGTCGGCTGCATTGCCAACTGTCGCTAGTGCAGTGGCCGTGGCAGCGACGAGGCCACCGCACCCGACACCAATCATGCCGTCCGTCAGTTTGCCGCTAC
CGGCTAAACCGCTGACAGCGCTGTCGATGGTTCCTCAACAACAACCGCCGCGAACTCCGATTGTGCTTCCACCTGCACATCGTTCACTTCCGCCTTTACC
GGACTTCCTCAATAGCCGCGAAGCTTTTAACCCCGCCACTGCCGCTGCTGCAGCTGCGTCGACGCGGCCGTCACGCCCTTCAAGTAGTGCCAGTCGAGCA
TTATTCCCGTCTATTACGGATCTACCAGCTACCCTTACAGATGCACAAGAAGCGGATTCCTATTTCCAACGATGAGCTGCAAACTACAAAGGACATGTCT
TTGACGGGTTTATACGTCGGACATTTCTTCTCTTTACCGCAATAGACTGTCAAGTTTGTTGACGCTGCCTTTCGCAAGGGGGCGATGTGGAGCGTTTACG
TGCCAGAGCGCTCGGAAAGCTTCGTGTGCATAGGCGCCGCGGTTTGCCAGGAGGAACATTTCAAGCTGCGTCTCGGACAAATTGAGCAGTTGGTAGTATC
TTTTGGCGTGCTCCAGACGTGAGGCCGACGAACAAGACGAAGGCATCGAAGCCGACGACGACAAGGACGCGCTGTCGTGAGGGTACGAGTACAGAGTGCC
CGTGAGTCCCTGACGAAGTGCACCAATGTTGAGCAGCATCTGCTGGACACCTCCACGTGTGAACGTGCAGCCCGTCATCTGCGCAAGATTGCCGATCAGC
AGGCGAGACAACAGCGCGTCCACCCCGTTGAACACCAGCGTCATCTTGTCGCTCGCCAGGTATGGCTGCAACGCGTTCTCGATGGATGAAAGGTTGAGGT
TGAGCGTTAGAACGGTGTCTTGAGCCATGGTCGGCCGGCCTTCTTCCATGTCAAACCGCTGCGAAACGAGTTGTGTGAGGTAGTAGCAACAGTGGAACCG
TACTTCACGACGCAGGAAGAGAAGACATTCATCAGCTAGAGCGCTGCACTGCCAGCTTGCAGCTTGGAGCGCCATGGTTAGCGCCGGCGAGGTGACAGGA
GATACTGGAGTGTTGTTATCGGTCCGTTCAGAACCTCCCGCGACACGTTGAAGGTACAGCGCTATGAGATCACAAGCACTGTTAGCGTAGCCGAGCATAC
CGATGCGCGCGTTGTCCATAAGGAGTCCATTGGAGCCTTCCATCCATGAATCGGGATCGTAGAGCCCACTCTCAAGCTCGAACTCCCTCGCTGCTATCAC
CTCCTCTGTACTCACCCTGGAGCTGCTAGCTGTTGCTCCAGTCGGCTGCACCTTGGAGTGGTGGAATGGAATCGGACTGCCTTGCTTGGCCCGTTGGTAG
CCTTCATACACGTGGAAAATGGCTGCGAGGTCCGCGTAGGTGACGTTTTTCGACTGCAGTTGCTTATAATTTAGCGTCTGCTCTCGAATGTCGCGCACGA
TAGCCGCGCATTCTTCCAACCAGCTCAGAACTGAAGCTTCAAGAACGCTAGCCA