Description :
From Genome Similarity Track
Location :
contig_5:584174- 585894
Sequence
1720 bases(100 bases per row)
TACCACCGTCTTGATTCGTGTGCTGCAACCATCTCATACAGAGCAGGTTGCGATATCGCAGGGTGTCGAAGAGATTTGCGTACGTGTCGAACGATTGGGG
AGTGGGGAAATCCGCTTGAAGTGTCCGCAGCGATGAAGCTCTTCCTCCATCTCTTTGATCAGCTGGAGGTCTTCGCCTTCGATCTGAGACAGCATTAAAC
TGCTCGCGGATCCTTGTAGCAGTCCTTCAAATGTCCGTCGCCGCCGTTGTGCGTCCTTTTCCTTTTGGAGAATCGTCGGTGTGACCCCCGCGCCAATTGT
CGAGGTTGCTTGATTCCATGTAGTCGGTCTTGTTTGGCCTTATCGAGCTGCTGGGCCTCCCTTTGTGCGTCCACAAACGGGATTCCTACAAGCTGGAACA
AGTCGCTAACGAGGACAGTTTTGATGCGTTTGTCCATCGGCGACGAGCTGCTGAGAGACGGAAAAACATTGACCTCCAGTAGACGGGGCTTCATGCTCTC
ACCTTCGAGCAGCACATCGAATCCGTACAGCTCGAATCCATTGCGTCGACAACTACTGCCGCTGGAGGCCGACGCTAATTTATCTTCGACTGCAATCAGC
GTTTTGACGATCAAGTCTTCGAGTTCTTCCTGGAAACTCTCAAGCTCACGAGTTTTGCCTTCGTCGCAAAGGTATTTGAAGAGCATCTGGAGACTCCATT
TGCTACTGGAGAACGCATGAGCTTCGATATCATCTTGATTTTTTTGAAAAGCTGCAGCATTTTTTGTTGTTGATGCTGTAGTTAGTAAGGTGGCCAAATG
GGTTCTGCAACTCGCTTTTGCTTGTGGAGTACTTTTCCGTGCAAAAGCGTACCAAACCGTCGTGAAAGAGGTGGATACGTAGAGGATCGTACGATGTCAC
CGCGACGTAAACTCGGAGGTCAAACTTGAGACCGTTGATTAGGAACGGATTGGCAACGTAGCGCTTCACAAGTTTGAGGCCATGAGGAAGGGAATACGAT
AATGTCAGAAAATGGTGATTCCCACTGAATCTGAAAAGGAAAATAGGGAGACATACCTGTACAACGTACGCTTTCTTCTTCGAGAGTTTTGGGGCTGCAT
GAGTACTCGCCGACACGAGTTTGATTCCCCTCCCACAAGACAAATTAGGCGGCTTGAGAATCCACACAACATTTACCTCAGCGTGAAAGCGAGACAAGAA
CTGCTGCTTATCGTAGTCGTTCGCTGTGAGATACGTCTCCGGAATAATATCCGCATAGGCGGTCGGGTGTTTCTTTCTCATACGCAGTAGGTGAGCACAC
AAGCGGTCCTTGCGACCTAGTTCGAAGCTGCCTGGAAAATGGTTTACACGCTGAAAAGGCAGCAATGCTCCAAATTCTTGTGCCTTGAGATGTTCACCCC
AGAAAATATTCCAGGTATTGTTGAATGCTGTTTTGCGAACACTAGTTGCTCGTAGTGAGTTGGTGATGGCATTGTACAAGAATCGCTTCGTAGCTGCAAA
GGATACACGCAGCTCCGATTCATTTCCAGAAATCTCGCGGACTGCACGGAATCAAAATCAAGAGATGGTAAAGCGAAGTAAGAAGCTCGTCTTTGAATAA
TCAGCCCAGATTGAGTCTTGCACCTTCATAGCCAGCAGGGCATGATCGCTCAAGTTGGACGGAGGCAGGATAAGGGAAGAAAAGAACTGGTTGCGAGGAC
GGCTCGATTTTGGAGACGAG