Description :
From Genome Similarity Track
Location :
scaffold_14:584120- 585260
Transcript NameFunction/comments
g6560.t1hypothetical protein

Sequence
1140 bases(100 bases per row)
AATCCATGGAGTATGGCTCATTTCCTGGAGGCACAAATGGAAATGGTGTTGTACACAAATGGATACGACAATGGTGTGGTGCACACATTATGCGCGAGCC
ACCCACTGCGAGCCGCAGCGATCTCCCCAGTTCAGCTTTCGACCAAGACACGAAAGCCAAGCTAGTTTTAAGGGAACGTTCCTATGTCCACAACACTGCA
CGACGCCATGACCGACTAAGAACCTGACAATACCCTCGGCGGCGCCACTACCGAGGCTGGGCCTCCCACGACGAACCCGGCTCCAGCAGAGGTACCAGCG
GCTGCCGCGGCAACCACGGTAGAGGTCGTCGACGTTACAGCTGACGGCGCTACGTCGACGACGACTCCGGTTTGCTCGACGACTGAGTCCCCTCCGATCC
GTGCGTCCAAGCGAGTGGCGAAGCGCAAGGCGCCCCCCCCCGCGCGCGCGCCTCAACCCGAAGTGCCGACGACGAGCGAAGATCGTTCGACGACCGGTGT
GGAGAGCTCACGTCCGAGCACGACGTAGCGGACGGATTCGGCGACCAAGATGACGCCACCACAGCCCACGGGGTTCGACCTCGCGGACTTCATGACGTCG
TTCGAGCCTAAACTTCTCAGCGAAGCACGACCTTAAGCTTGAGCTCGTGTCGAGGAATCTCCGGCTGCATCCTCGTCAAGTGTCCAAGAGCGTTTATGCC
AGGAGCTCGAAAGCCTGAGGGGCCAAGTCGCAGGCGTGCGTCAGTTGCTAGCTGTGCTCACCGAATCGAACGATGAAGGCAAGCTTCCAGCCGACAGCGT
CCGTCAACTGACAAGCGCCAGTTTCCCGGAACAAGCGAAGAAGGCCAAGGGCGACTATCATCCTCGCAAGTGCACGTGCAGGCTGCGACTCGCATGTTCA
AGGGCCTAAGTCCGACGGAAGTTAAGCCCATCTCTCCCATGTTATTTGTGCTAGACTTACGTGAGGCGGAGTGCGTGGGGTTCAAGGCGACCCCGGTGAT
GCTGATGGCTCTCTTCTCCGGTCGACTGGGCGCCCGTGGCCTGATGATCCTCCACTTCCGTGAGGAGAATGAGCAAGAAGCGCTGGAGGATGGATCGTCC
AGCAGCAACTTCGCGAGCGACTTCAGCCCGTCAGCCACTT