Description :
From Genome Similarity Track
Location :
Scaffold_972:584- 5419
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh-pir_contig_972-abinit-gene-0.30Calmodulin-binding transcription activator
Pytir_DAOMBR486maker-pir_contig_972-snap-gene-0.5Conserved gene of unknown function

Sequence
4835 bases(100 bases per row)
GCGGCGGCGATTGACGCGCGCGCCACGACGCTGCTGCGGGATGCTGCGACGCGCTGGTTCGTGAAGGAGGAGCTCGCGTTCCTGCTGCTGCACCACGCGC
AGCTACGTGCGCTGCCGATCTACCACCAGCTGCAGACACAGCCGCCGAGTACGTCGTCTGTCTCTCGAATGTGTTTTGCTCCGCTCGACACGTCACGTGC
TCCAAGCAGCACGCCTCGAGTTATTATGACAATGTGTGAGTGTGCATGCTAACGAGGGTGTTGTGTATACGTGTGTACTTCTCTATATGTGTTGTGTGTA
TTTGTGTGTGTGTAGGTGGACGTCTGCTACTGTACGACACGAGGGACGTGCCCGATTTCAAGAAGGACGGCTGGCAGTGGCAGAAGCGGAAAGACCAGTC
CGGGCGGGTGGGTGATTAACTAGCGAGAGAGGCGCTGTGTTGGTGATATTGGAGTATTACTCACGCGAATATGGCGCTGTGTGTGCGATGTGATATATTT
GTGTTTGTAGATTCGAGAAGACCGCGCCAAGCTGGTGATCAACCGCGAAGTGATCGTATTGGGCACTTACGTGCACTCGTCCGATATTGCGGTGTGTTGT
TGATAGCAGACAACGCTTTAAGGGCGGGTTGAAGTGGAACACTGCTGACCATCACTCTCTCTTTTCTCTTCTCTGTGTATGAATGCACAGACTTTCCACA
GACGGAGCTATTCGCTGCGAGATGCGAATCAGCACATCGTGCTCGTCCACTACTTCGATGAAGCCAACAAGGTCGGCAGCACTCAAGGCAGTGTTGGCAG
AAGGAGCAACGGAGCAGTCACATTTGCTACATCTTCAGCGTCTGCTTCTCAGAAAGGGAATGGCACAGCAGCAGCAGTAGCAGCAGTGATGGCAAAGGGA
CTCAAGCGCGCGCTTCCTGTGTCAAGAAACAGCGTCTTGCCTTTCATTCCCAGTACGATGGCGCCGCAGTTTCCAATCAAGACAAAGATGCAACAACCCG
AGATTGTATCAGAAGAGAGCGTCGACGCGATCATGAACAGTACGTATCATCTATCCTGGGGTTTTCGGCTCGCATCCGAGAGAGGTGGGTATGAATATTT
GCTTACGCTCTATATCTATCTATCTCTGCTGTGTTACTTTGCTTGCTATCAACCAAAGACTGCTTCGAGATGGACTTCATGCCGCAATCGGCGCCACGAC
TGGATGAGCAGCTGCATGATTACGCTACGCGAGATCCGGATTTCGACCTGCTGAAGAGTGGCAATATGATGCTGGGAGGGCTCTCGGATTTCAGTGACGA
ACTGCTGTACCCTGACGCCTCTCCGTCATCGTCTTCGTCAGGACACTCCGCAGCTCACATCCGAGGGACGGAATTAAATGCCGCTGTTGCTGCAGTCACT
CCAGCGCTGATATCAGACTTTTCGCCAGATTGGGATTTCACGGAAGGTGGTGCGAAGATTTTAATTTGCCTCGCGTCTCCGCTTCCTCAGCATGAGGGCC
AGTCGAGCATTTTCGTTCAGTTTGGGATTCTCAATCGCGTTCCAGCCGAGAAAATCTCAGATACCGTCGTACGATGTACAGGTGAGTGCACGTTTCTCTC
TTCGATTTATTGAATTTGGTTTTGCTAAGTTGCTGCCCACTCAATGTTCTACGCTGTCTTTGGTGCTCTACCACAGCGCCTCCATTGAACAAGACTGGAA
GCGTCGAGATCTACGTTTGCAGTAGCCAGGACCGGCTTCAACCAGAGTGCGCGCAGTTATCCAGCAAACGGATGTTCACATACAAGAGCAATCATCAAGC
GTCTCCGCCTCTTAAACCAGCAAACGAGAGTGCAGCAGAGCAGACCAGTTTGAGTTTACATCGTAGAGCGACGATGAACGAGATTGCTTCTGGGAAGCGA
GGACGATCTCCTCGTCACATTGGAGAGCAAGTGCTACTTTCAGATCAGCAGAGCGACAAGAAACGCAGCGCTCGCGCGTTCGAGACGTCAAATCTGTCAT
CATTTGTCGACACAGACTGTGAGTTACGTTCTCTTCCCCCTCCTATATGTGTCTGGTCTTATTGCTAACTCTTGTGTGTCTGTTTCTGTACAGTGGACGA
ACGACAGTGCAAGATTCGAGTGGTCGAGCGGCTTTCCGAATTCCATCACGCGATCTGGACGACCGCGTCTCCTGCCGAGCCTCTTGGTGTGCCGAACGGC
AGCTCGTTTCTGCCAAAGCCAATAGACATCAAGATCAAAGAGGCCGAAGGCAAAGCTGAACTGTCAACATTGTCTACTGTGACTAATGGCTCCAGCGGCG
TCCAGCCACCATCACCACCCGCGTCTGATGAACCATCACCAACTGATCCTACGACTGCAGGTTTGCTTGGTCTGGATGACTCTACAATTGAGACACTGAG
CGATCAAGATCTCGAGCAACTGTCAGAAAAGCTCCTTGAGCGGGTCGTTCGACAGCTTGTCACCGTCGCTCACACGAGCGAAGAGTTACTGGAAGAGCTC
AACTCTCTCGACGAGGCCGGGTTGAGTCTGCTGCACTACGTGAGTTTCTACAACTACTCGTCGTTGGTGCCTCTGCTTCTCTCTCACGGAGCCCAGATCA
ACCAGCAGAGCACGCAGGGTCAATCTGCACTGCACTTGGCTGCTGGATGTGGTCACAAAGACGTCGTCGACGTGCTGGTTCAGTCTGGCGCAGATATGTT
TGCACTTGATTTTGATGGCTTCACCCCAGCCGATCGAGCAGACAAGTCAGAACATTCCGAAGTCGCTGTGTATTTGCGGCGGCTGATGGGGTTTCAAGAC
GCTGAGCATACTGAAGAGAAACATATGAAGAATAGCCCTTTGCAAGCCTCCACGGACGATTTTTCCATGGACATTGACTTTGGCGCCGACAGTTTCGAGA
ATCTGGAAGAGAACTCGACTGACGCGATGATCGAATTCGGATCCCAACCCAGCACTTGTGACAGTCCAGGAGAATTGAGCGGTGCTGCCAAGCCGAAAAA
TTATGTAAGTTTGAGTTCACTGTGTCCTGCGAGCTGTATTCTTTCGAGTGGTTAACTCGTGGTTTATGTGTATGCGTGCGTATGTTGTGGAATAGGTTGG
AGAAAACCACGAACACAACCGCAAGCTTCTTCTTGGTGCATTCTCCACGATGAGCTTACATGACAAGTGCGCTTTGTCTTTGAGCATCTCGAGAGACTCA
AGTACGAACGGCAACAAACGACGAGGCAGTAGCATTGGCGATGACAGCTTTCTGAATTCGAGTGTTGGTGGTGGAACTCCTGGTTCCCTAACTTCGTCGC
CAGCACCAGACAGCGATTTCGCACTTGGGTATGAGGTGACCGAGAACGACTCGTTGTACGATTCCGACGTGAAAAGCGTGATCGCTGATGACGAAGAGAG
TTTGACAAAGTTGGAGGCCGCGATGGAGCTCATGGGTCCCGAAGAGCGCCAATGCCTCGAGGACGAGGTGAAGCTGCTTCAGCACAACATTCGCGCGTGG
CTGCTGAAGCGCAACTGTAAGAATATGCGCGAGACGACCAAGCGACTCCATGAAGCGACAAAGAGCATCAAGGACCAACAGAAGCAACAAGAGCAGCACC
AGGAGGCTACAGAGCGGGAGATCATGCAACAGAACGAACTGTCGGAGCGTGAGCGTGCGGCAGTGACGGTCCAAGCTGCGACGCGAAGCATGCTTGCGCG
CAAGAGCTTCCTCCAGACCAAGAACGTGACGATCAAGGTTCAGGCTGCGACGCGCGGCGTGCTGTGCCGCAAGAACTTTGCGCGCATGAAGACCCACGCG
CTCGCGTCGCTCGTGATTCAGAGGAATGTGCGTGAGTGGTGGTACAAGCAGCCGGGGGCTCTGAGGACTTCCACGTACGAGGAGGGTGATAATTTACGTC
CTGCCTCAGGCTCAGAGGAGATCCACACCATAGTTGAAGAGTCGAAAGAAGACGAAGCAGAACTAGACAGATAAGGCACTCCATATAAGCGAATAAAAAC
AGCGCCACTCGTACGCTTGGTTTGCTATCATCTGCACTCGCACACAAGGCCACAGGCATTCGTTCATCTATTATCATCATCATGCTGCTACCTTTCGACT
CCGCCAGCACTGCGATGCTGTTTGTACTGTCTTCTTTTGTGGTCGTTCTCTCTGCTGCTGCTCGCTGCTGTTTACTATCGCTCCCCTCGCGCAGTTTGCT
TATTCAGCGCCTTCGTCCGTGTATCGTCGGAAGCCCTCGACTGGCGGCGTCCAGGTCGCAAAGCCGCGCTCCTCCGGCACAGGCGAGAGGTCCAACTCCA
TCGCCTCGTCCTGCAAGTGCGCTGGGAGCGCGTTGATAGCCTCCCACTTGAGGTCGATCTTGGTCTGCAGGTCGCGCTGGAAGTGGTTGTGTTCGATCGT
AGACAGGATGTTGAAGCGACGACCGATCTCCTGGAAGCGCTGCTTGTCCTCCTCCGACCACGGCTCGCTGTCAAAGGCGGACACATACATGGGATCAGAA
TTACGTCAGCATTTCGTGCATTATATAACCTATACACCACACATGTAGTTACAAGGTTGCGAGGCAAATGAACGTACGCCTCTGGGTAGCGCCCCTTGAT
GTTGCGCAGCATCAGCTCAAAGTTGGCGTCTTCGCTGCCCTTCTTGGAGCCCTTCTTGCTCACGGTCTTCTTCTTCTTGGTGGCAAAGCCACGCACCAAC
ACCTGCTGCTGCAGGCTGGCAGCGACCACCGCAGCACCAACGGTGGCCGGACGCACCGCCGCCGCCGTCACGACCGAGAGCTTCACGCTGCGCTGCAACA
CACTCGCCATCACTTGCTCTCGTTCTTGCTCTGGA