Description :
From Genome Similarity Track
Location :
Scaffold_698:5839- 8350
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_698-snap-gene-0.12Polyribonucleotide nucleotidyltransferase

Sequence
2511 bases(100 bases per row)
TCCCCAGCCCGCAATGCCTTGATCGACATTTTGCCCGAGACGCCCTCTTGCAGGCACGCAAACTCGAGCACCTGGCCGACCTTGATCACGTCGTGGATGT
TGGTCACGCGCGTGTCGGCCAATTCCGTGATGTGCACAAAGCCGCGGTTCTTGGTGGGCGCTGTGGCCTCCAAGATAGCGCCAAAGTCCATGACCTCGAC
GACGCGCATCTCGTACTTCCCGCCCACCTTGTAGAACGAATGGGCCGCCGACCCCGTCTGCTCCTGGATGATCGCTTGGGCCGACTCGAGGGCCTCGGCC
GGGCCGGTCACGCGGATCTCGCCCTTGTTGCGGTCCACAATGCTGATGGAGCACCCGGTCGCGTTCTCAATCTCACGAATCGTGGAGCCGCCCGTGCCGA
TCAGCGAGCCGATGGAATTTGCCGGAACGGAAAACTTGATGACGCCGTGGACGCCGCTCGTGCCTTCCGTTGTGCCCGTGACAGCCGACGTGGTCGACTT
GAGCTGCTCGCGCGGCGCCGCGAGCTCAGCGGCCATGCGCTTGAGCACAAAGCTTCGGGCTTTCTTGGCGTGCTGGAGCCCCTGGCACAAGATCCGCAGC
GGCACACCGGGCAGCTTGACGTCCAGTTGGATGGCCGTGATGCCCGTGTCCGTGCCGGCGATCTTGAAGTCCATGTCGCCATAGTGGTCTTCCGTGCCCA
AAATGTCGGTGAGCAGGCGGTAGCTGNNNNNNNNNNNNNNNNCGTCGAACGGATCGCCCTCCGTGACCAGTCCGATCGAGATGCCGGCCACGGGCGTCTT
GATGGGCACGCCGGCATCCATCAGCGCCATGCTCACGCCGCACACCGTGGCCATGGACGACGAGCCGTCCGAGCCCATGGTCTCAGACGTCATCCTCACG
GTGAACGGAAACGTTTCGGTGGACGGAAGCACGGGCACAATCGCCTTTTCCGCGAGCGCGCCGTGGCCGACCATGCGCCGGTTGACGCCGCCCATGCGGC
CTGTCTCATTGACGCAGTACGGCGGGAACTCGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGTGGAGAATGGCGTGCTTGAACTCGGCCTCGTTCTT
GGGGTTCTGGTGGGCCGTGCGCAGGCGCAGGCCGCGGTCCAGCGGCCCGAGCGTGACCGAGCACAGTGCCTGTGTGTCGCCACGCCCAAACACGGACGAC
CCGTGGGCCATGGGCAGCACGTCCGTCTCGATTTGCAGCGGGCGAATCGTGCTGTGCGAGCGTCCGTCCAGCCGTGAGTTGCGGTCGCCGGCCAAGATGC
GCTCCCGCAACGCCGTCTGGACCACGTCGTGGGCCGCGATCTGGAACAGGTCGTCGTTCACGTCCTCGCGGCCGGCAAAGGCCTCGCGCAGGCCCGCGAG
CAGCGCCTCGTACGTCTCGTGCTCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTCCATCTTGGCAGCCCGCGGTCCGCTAAAGAG
CTGGCCGACGCCAATCTCTCGTGCCTTGGTGGCCACGTCCTCGGGCACGACCGTGCGCACGTACTCGCGCTTGGGCTTGCCGTACTGCTCGACAAGCTTC
TTTTGCTCGGCCAAGAGCGGCTGGACCTTTTCATGGGCAAACCGCAGCGCCTCGGCCATGCGGTCTTCGGGGATCTCGTGGCCGTCGGCCTCGATCATGA
GCACGCGGGTGGCGTTGGCGGCGTAAACAATGTCGAGCGTCGCGGCGTCGCGTTGCGCCTTGGTGGGGTTCGCCACGAGCTGCCCGTTGATCTCGACCAC
GCGCACGCAGCCGACGGGGCCGTTCCACGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGAC
CGCGAGCACGAGCGGATCGTTGGCCGGGTCGAGGCTGTGGACCGTCGCAATGACCTGCGTCTCGTCGACATAGTCGCGTGGAAACAGCGGACGGATGACG
CGGTCGATGATGCGCGACTCGAGGATCTCTTCGTCCGTGTTGGTCATTTCGCTGCGGCGCTGCGTGTCGGGAATGAGCCCCACGGCGTGGAATTTAATGC
GGTAGTCGACCATGAGCGGTAGAAAGTCCTTCTTCTTGGCACCGCTCGCGGACGCCGGACTCACGGTCGTCGAGAGCACCATGGTCTTGCCCTGCGTGCT
CATGATGGCACCGTCGGCGAGCCGCGCGTACTTTCCCACTGAGTACTGGATCGGATCCAGACTCCCGACGAGTGGCTCGGCGGGTGCCTCCGGCTGCTCC
ACAGCCGGNNNNNNNNNNTGGCGCTTCGCCAGCGACGGCCGTCGTGGCACTGGCATCCACAGTAGCCGCCTGCGTGGCAACCTCGTCCGTGGTTGCGGTA
GCATCCTTCTTCTTGTCACCGATCAGCCAGTCCTTGAGCCCAAAGAACGTGCGCACTTGGAGCTGCTGGTGGTGGCGCGACGCGAGCGGCGCAACGTGTC
GCTGGAGCGCG