Description :
From Genome Similarity Track
Location :
contig_120:58376- 61719
Transcript NameFunction/comments
g11378.t1Amino Acid/Auxin Permease (AAAP) Family
g11379.t1hypothetical protein PHYSODRAFT_517932

Sequence
3343 bases(100 bases per row)
CGCCATGGCGCGCAAGCCTGCCTTCACGATGGAGGACGCCAAGGCGGCTTTCAACCTCTTCTGCTGCGTCTACGGCATTGGAACGCTTGGTATGCCCGGC
AACTTCTCTCGTGCCGGCCCCGTCATCGCCGTCATCGCCATGGCCTTCATGGCCTTCGCCAACACGTACTCCTCCGTGGCTATCTGCCGCGTCATGCTGC
TCGCTCCCCGTTCCGTCAAAACCTACGGTGACCTTGGCGAGTGGTGCATGGGCAAGACCGGTCGCTACCTGTGCGTCATCTCTCAAATGGGCAACTGCCT
GCTCGTCCCTTGCGTCTTCCGTGCTCGGTGGCACTCTGCTCGACGGCCTCTTCCCGGAGGCTTTCAGCCCCTCGACGTGGGTCATCCTCATGGCGGTCAC
GTGTCTGCCGGTGTGTCTGGTGCCAACTCTCAAGGAGGAGCTGGTGCTGCCTTTGCGGGTTGCATGGGCACGCTCATCGCTGATATTATCGGCGTCTCGG
TCGTGATGTACGGCATGCGCGGTCACCCCAGCGTGCCGAAGCCCGACCTCGCCTTCAAGCAAGTGGCTGGTGCTTTCGGCAACCTGGCGCTCGCGTACGG
AGCCGGTATCGTGATTCCGGCGCTGCAGCGCCAGCACAGTGACCCCACGCGCATGCCCCGTGTTGTTGGTGTCACGATCGCGTTCATCTCGTGCTGCTTC
CTGGTTCTGGCTAGTACTGCGTACTCGTCCGTCGGCTGCCAGATCTCGGGCAACTTGCTGTGGTCGATCTACCCGGACACGGAGACTGGCCTGACCACGC
TGGGCTTCGCGTCCGACTGGGGTGCCGTCGTCCTCGCGTACCTCTTCATGCAGCTCCACATTACGATCGCCTTCTCTGTCATCCTGAACCCGGCCTTCTA
CATTTGTGAGCGTATCGTGCTCGGCATGCACAAGCAAAGTGCGGATGATATCGAGAACAACCTTATGAGCTACGCTGATGCAGCCACACCCGCAGACGTT
GCTGAACATTCGGAGAAGGAGTCCCGTGCTTCCAAGCGTTCGTTCATTTCGGTGGCTGATAACGAGAACGTGCACCTTGGAGACGACGAGTCCGAGGCTG
CCGAGTATCGCGGCGCGAACGCTATCAAGTATGTCATTCTTCGCATTGTAATCATTGTGATTCTCGTCATTGCGTCGGTGCTGCTGAAGGACCATTTCTC
GGACCTGGCGGACTTTGTCGGCTCGTCGTGCATCACAGTGAACTCCATTCTCTTGCCCATCGTTTTCCTGCTCAAGAAAAAGTGGAGTGTTCTTCCAATG
TGGGAGAAGCTTCCAGCCCTGACGGTGGTCGTGGTGTGCTTCTGCCTGGGCTGCTACGTGACATACACGTCGGGCAAGAACCTGTTTGCCCCCAGCGACG
ACGAGACGTCCTTCCCGTTCTGCGCGCCCGAGTACGAGAACACCGTGTACTACAACTACACGGCTGCTCACGAGAACTAAGCGCTGGTCTGAACTTGAGA
TTGTTGTCGCGTGAAGCTGTCAGTAGACTATACCAATACACAACGTTTGCTTTCTACTACGTCAATAATTTGATTAGACCCTTTACAGCTATTATAGAAC
AACAGGACCACTAAGGAGATCAGCATTATGCACGATCACCTCCCAGCCTTGTCGTTTACGATGAAACAGGACTACTTAAATAGTAGGGATAGTGTGTGAC
CAGGACGCCACCGTCAAGCTACCCACCTACACATGTGACTTTCAAGACAGCGAGCTCGTGCCACTGAATGAGCGTAAAAAAAACAGATCGGTTTTCGATT
TCGTTTACATCAACCGAAAAACGGCAACACTTCGTTCACCTAGCTTAACTCTCGTGCACGGCAGTGTAGTTGTAGTAGACAGTATTCTCGAACTCGGGCG
CACAAAACGGGAAGTCCCTGTCATCCTCGGTAGGAGCAAATAGGTTCTTGCCCGACGTATACGTTACGTAGCAGCCCAGACAGAAGCACACCACGATCAC
GATAAGCGCCGGGATCTTCTCCCACATCGGTAGCACGTTCCACCTCTTCTTCAGCAGGAAAACAATCGGCAAGAGGATCGAGTTCACCGTGATACACGAC
GCACCCGCGAAATCGGCCAGGTCGTGGAAGTGGTCCTTCAGGAGCACCGATGCGACCACCAAGAGTGCGATCATGATGATCCGCAGAACCACGTACTTGA
TGGCATTCGCGCCGCGGTACTCGGCAGCCTCGGCCTCGTCGTTGCCGAGGTGCACGTTCTCGTTGTCGGCAACGGAGATGAAGGAGCGACGCTTGGAGGC
ACGTGACACGTGCGACTGCTTCTCCGAGCGCTCGACATCAGCGGGTGTAGCAGCATCGGCATAGTTCAGAAGGTTGTTCTCGACGTCATCGACGATGGGC
TTGTGCATGCCAAGGATAATACGTTCCGCGATGTAGAAGGCCGGGTTCAGGATGACAGAGAAGGCGATCGTAATGTGGAGCTGCATGAAGAGGTACGCGA
GGACGACGGCACCCCAGTCGGACGCGAAGCCCAGCGTGGTCAGGCCAGTCTCCGTGTCCGGGTAGATCGACCACAGCAAGTTGCCCGAGATCTGGCAGCC
GACGGACGAGTACGCAGTACTAGCCAGAACCAGGAAGCAGCACGAGATGAACGTCATGGTGACACCAACAACACGGGGCATGCGCGTGGGGTCACTGTGC
TGGCGCTGCAGCGCCGGAATCACGATACCGGCTCCGTACGCGAGCGCCAGGTTGCCGAAAGCACCAGCCACTTGCTTGAAGGTGAGGTCGGGCTTCGGGA
TGGTCGGGTGGCCACGCATGCCGTACATGACAACTGCGACGCCGATGACGTCCGTGATGATGGTGCCCAGGCAACCGGCGAAAGCAGCACCAGCTCCCTC
CTTGAGAGTTGGCACCAGACACACCGGCAGACACGTAAGCGCCATGAGGATGATCCACGTCGTCGTACTGAAGGCTCCCGGGAAGAGGCCGTCCAGTAGC
TGACCGCCGAGCACGAGGAAGACGCAAGGGACGAGCAGGCAGTTGGCCATCTGCGAGACGACCGAGAGGTAGCGGCCCGGCTTGCCCATGGCCCACTGAC
CCAGGTCGCCGTAGGTCTTGACGGAACGGGGAGCGAGCAACATGACGCGACAGATAGCCACCGCGCCGTAGACGTTGGCGAAGGCCATAAAACCCATGGC
GATGACGGCAAGCACGGGGCCGGCACGAGAGAAGTTGCCGGGCATACCAAGCGTTCCAATGCCGTAGACGCAGCAGAAGAGATGAAAGCCGCCTTGGCGT
CCTCCATCGTGAAGAAAGCTTTGCGTGCCATGGTAGGGGCAGT