Description :
From Genome Similarity Track
Location :
Scaffold_20:583734- 591628
Sequence
7894 bases(100 bases per row)
ACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTC
GTTGCCATGGATAGGAACGACTTCTCCCATTTGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCC
TGGTGGTGTCAACACCGGCTGAGCAGCTGGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCC
GGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAA
GTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACA
CTCGGGAAGCAACATCCCCTGGATGTTTTACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCG
TTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAAT
GAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGTAGGCAAGCACCCTTGAAGAGGCGATTC
AAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGCTCCTTGTCGGCTCCCGGTCGAACAAGTCCCAA
CGGACCAGCTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAA
ATACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCCGGGAACCAGTAGGGGCGGG
GCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGAAGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCG
AAGAGCAGCGGCGGGTTGCTCGTAGTACTCGGATGTGTACGGGGATACCATCATCCCTCTAGAATCTTGATCGACTCTGGGGCGTCGAAGAATTTCGCAC
GCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAAAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGT
CGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATG
ATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATTGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCACTGG
TGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGA
CGACTCCCAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGTCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGCTCCGCAGACAGCT
GCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACG
CTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTATCACA
CGAGGCAACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACACCGCCGCCGC
CTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGATCCTCCGACAAGGCCGGTGGAAGAGTGTTATC
ACATCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGCCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGAC
GGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTC
TTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTAGGTTCTGAGATCCTTAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGA
CGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTG
TGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCC
CCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAA
CACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCG
AGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGAGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTC
AATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGG
CCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGA
GATTAAAGTTCTCGGTTGCTTCGTCAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAG
GATCTTCAAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACG
TCGACTGGCGCTGGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGCCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCC
GTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCCGG
CAGCTCAAAGCCGCCGAGCGGAGCTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTA
GGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGA
ATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCGCGCGGGTG
ACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCG
ACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACCGATCCTCCACGGGTGGT
CGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTC
TCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGG
CTCCACTACAGCGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAAT
TTTTATGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTG
TTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAGCTCGTC
TGCCGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCC
ACGTACGTGGTCGTCGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAGCGGCTTCCGC
CACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGA
GGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGACAAACA
AAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTT
AGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGTGTCGTACACCATCGACCTTCCAGAGTCAA
TGAAGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAG
CGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTC
CATACGAACGGACCCCGGCGCCATACGCCGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAA
AGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACC
AGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCGAGTCCCAAGGCCAAGTGCAGTCTCAAGCACGA
GGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTTGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTA
CTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGTTTAAGCGAC
AGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGA
ACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACAGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGCGCGCTAG
AAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTG
CTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGGGCATGTCCTCACAGGAACTCCACGTGGGACAGTTC
TCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTAAAGTCCTTAAGGGGAATGCGGTGTT
GCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCC
CACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGG
CTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCCGGTCGAGGTCATTCGAGACCTCTCGGGGCTCAACGA
TAGCACCCTCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAG
TGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTTGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGA
GGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTGATCACCGTGATCACTAGCGAAC
GCCTGCACGCTGCCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGGACTCGGCATCGTCTT
CACTGCCCGAGTTGAACTCGCGTTCTACGAACCGAGGGCTCGGACGGTTGTCTGAAGACGAGGGCGACGGACTACTGCGCCTGCTTGCGCGCTTGTCCGC
AGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGTCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCC
GTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCGCGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGG
TTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACC
TCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGGAGTGTGACACTTC
ACACTTCAGGAGTATGACACGTCATACTCCGAGATATTTGGTACAAGGTACCAAGGTCGTTCAAATCCAACCAATGGTTAAATGACATTGCATTTCTATA
GGTAACTAACAGTTTGTATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTTTAATAAAA
GAGGGGACCTGTGAGCTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACAGAT