Description :
From Genome Similarity Track
Location :
contig_41:58373- 61303
Transcript NameFunction/comments
g7187.t1hypothetical protein

Sequence
2930 bases(100 bases per row)
GTGGTGCCCTGTCCTGCTGGACTCGGGCGTGTCTCACCACCTGACGGGCCGACTGGAAGACCTCGTGGCCACCCACACGAGCCCCGCGCTCGCAATCAAG
GTTGCCGACGGTCGCACGGTTGTCTCTCAAGTCAAGGGAAGGATGATGATCCAGGCGATAGTAGACGATGGAAAAGGAGGAGTCTCCACGCGGGAGTTCG
TACTTGAAAATGTCTACTACGTGCCAAAATTTCCCAAGACTTTGCTTTCAATCTCGACCCTGGTTCGTACCGGACATGACGTGGAGTTCACGCCTCGTGG
ATGCACGGTTTTTCGAGGAAATCGTAGACGTGGGGTGTATTTCGCGCGTAGAAGACGGAGTGTATCCCGTGCTCACTCCGGAGAGCTTGCTGGGATCTGC
CAGCGTCGCCATGTCGTCCGCGTTCGCAGTGCTGGGACGCGATCTCGAGACCTGGCATCGACGCATGGGGCACATGAACTACAAGACGCTCAAGTGGATG
GCCGCAAACAAGATCATTAGAGGACTGAACATCCAGCCTGGAGCAAAGCCGCCTGTGTGTGTAGTGTGCGCACTCACCAAGTCTCTACAACACGCGCCGC
CAGCGGAGCGAACGAGCAGTGACGAGTTCCAGGATGGCGTCGTGCACGCAGACCTCAGTGGACCACTGGCAAAGACGCGTGGTGGCCACCGGTACTTCAT
GGTTGTGATCTGGCGCGGCTTCCTTCAAGTGTATCTACTCAAGAAGAAGAGCGAGGTAACAGCAAAAGTCCGAGCATTCTTGAAGCTAATCGAGCGCCAG
GCCGAAGTACCAGCAACCGACATCAAGGTCATACGGACAGACGGCGGGACGGAGTTCCTCAACAAGGATTTTCGTCGGCTGGTCCAGCAAGAAGGCCTGT
GGCAAGAACACACGACGCGCTACAGTTCTTTCCAGAACGGCGTCGCTGAACGGGCCATCCGGTCAGTCACGGAGATGGCGTCCGCCATTCTCACAGATTC
GGGATTGCTACATCAGATGTGGGGAGATGCGCTGAAGCATGCAGCGTTCCTGCGCAACAGGATCCCTCGCCGAGGGGAGACTGTGAGCCCATTCGAGAAA
ATATTCAAGAGAAAACCAGACGTCAGCAAGGTGCCAATATTTGGACAAGCTTTGTCCGTTCGTGTCCCTGATGAATTCGGATCAAGTACCAGCGGTTCTC
CAACACGCGGGGCCAGCTTGGTGCGTTCGTCGGTTGCACGGATGAAGTAAAGGGATACCAGGTCTATTTGCCAGGCCCAGGTCACCCAGTCTTTGAGGCT
CACAGCGCTAAACTGATTGATCGAATGTACCACGAGCTGGAGGACGTCGGCGACGACGACCCCGACGACTTTGCTCCGGATAGCAGTGACGAACGTGACG
ATCAAGATCAGCAAGCAAACAATTCAGACAATGAGGCTCCGCATGAGTCGCAGTCTACGGCAAAGCGCCGCTCCCGTCGCATCGCGGCCCAAACATCCTT
CGCTGCCGTCGCTTTTGTGGTTCTGGGGGAGGTTCTCCGTGAGCCTCTAAATCTGCGTGAGAAGATCACCTCAGTGGGCTGAGTGGCGTCAAGCCATCGA
GAAAGAAGTCAAGGCCCTGTTCGAAAATGGTACATTTGAGTGGGTGGATTTGCCTCCCGGCGCGTCAGTGCTTGACCACACGCTCCAATTTCGCGTGAAA
ACTGGTGCTAATGGAGAGGTGATCCAGTTCAAAGCCAGGCTGTGTGCCCGGGGATCGACAGCAGTACATGCTCGACTTTCTGGACACCTACGCGCCTGTG
GCGGCTCTGACGACTGTGCGCATCTTCTTCGTGATCGTTGCCAAGCTGCGACTTGTGGTTCGTCAAGCCGACGTGCCCGCAGCGTATGTCAAGGCAGATC
TCCTGGAGGAAATCTACATGCGCCCAGTCCCTGGATTCGGGACGCCAGAGCAGCGTGGAAAGGTGTGGAGGCTTCGAAAAGCCCTGTACGGGCTCCGACA
GGCAGGTCGCGAGTGGAACAAAGCTATCGACGCGTTTCTCAAGGAATATGGGCTGGTGCCCACGGAAGCTGATCCCTGCTTATATTTCATGTACATTGAT
GACTCACTTCTCTTGGTATGCCTGTATGTAGACGATTTGCTAGTGGCGCATGCCAACGAGGAGCAAGTGTTGCACCTGATGGTGGCACTCAGTCTCAAGT
TCGATGTGAAGGACATGGGTACACCCAGTCAATTCCTCGGCATGTGTGTCGAGCGTCCGAGCCCGTCGATCGTGTTGCTATCACAAGCCTCGTACGTGGA
CGAGGTGTTGCACCGCTTTGCGATGGACGGGGCGCGCCCGACCAAGACACCGATGGTCCCCGGCACTCGGCTGGACTTGATGGGTGGTGTGGTTCCTGAA
GATGAAGCCGTCATGATGAAGAGGATGCCGTATCGGGAAGCTGTCGGAGCGCTTCTTTATCTGGCTCGAGTGACAAGGCCGGATACCAGCTTCGCAGTTG
GACAGCTTGCAAGACATAACGCGCGTCCCAGGAAGGTCGCTTGGGATGCGGCGAAGTACCTCATGAGGTACTTGGCCGGCACGAGAAATATGCAGTTGAC
ATTGGAGCCGACCGGTGAGGACATTACCGTAGCCTCCGACGCTGACTGGGCGAATGACCAAGTGGACCGCAAGTCAATTTCGGGCCGCGTTGTGTTTCTC
TTCGGGTGCCCAGTTGCTTGGGCTAGCAAGAAGCAGACTATTGTGACGAAGTCGAGTACTGCCGCGGAGTATGTGGCTGCAGATGACGCCATTGAAGATG
CCGAGCTGGTGCAGTTGATCGTCGAGCAAGTCCTGCGGAAAAGGGTACCGCTTGTGCTCGCGATGGACAGCCAACCTGCCATTGCTCGTCTCAAACGCCA
AGGACTCAGCGAGAAATCGAAGACGGTGGA