Description :
From Genome Similarity Track
Location :
Scaffold_1519:5837- 6994
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1519-fgenesh-gene-0.3HECT ubiquitin ligase

Sequence
1157 bases(100 bases per row)
GTCGTGAAGCCGTACTGCTCCGTGTCGAGCGTGGCGTACAGCACCATTTTCAGGTCGTCCTGGGAGACGTGATGCGGCAGGTCAATGCGGTTGAAGCACG
CGTGGCCCACGACGTACCCGTCGTTCACAAGCTTGACGCCCTTGAGCGTGAACGGACAGAGCTTGCCGTCATAGCTCGTGAGCGCACCGAACCCGGCGAG
CGGCACCCTGGACGAGCCGGTCGCAAACAGCAGCAGCCGCCGCCGGTACTCGTTGGGCATCTCGCGTACGATCTGCCAGAACCACTTGCGCGCCGGGTGC
TTGTCCAAGTCGGCCGAGTACAGCGTGTGCTTCTCCCAGTCGTCGACGTCAATCTCGTCCGACCCGCACAGCACGTGGTCGAGCTCTTCCGGGTCGAACA
TCATGATGAGCTCCTGGGGCACGACCTCGTAGAGACCGCTGAGCAGCGCATAGAGCTGGTCCGAGACGCTCTCAAAGAGCATGTGCTTGAACTTGCGCTC
GAGGAACTCGCGCTTGTTGGCGTCCGTGACGGGAATATTGCGGCCATTGCGGACGAGCTCGGTCGTCACGACCTCGGCGCTGTCCGGTGCGACTTGCTCC
GTGACGGTAAAGTCGAGCCCGAGCTGGTCCACATTGTCATTGTCGAGCATCCACATGATGCTCTTGTAGGCCTCCGGGTCGAAAAACTCGAGGTCGTTGA
TACTCACGGGCATGCCCAAGATGATCTTGAGCAGTGGCAGCGCAAAGTGGAAGCCCGTGGCGAAGCCCTCGAGCAGCGCACGGCCCAGTAGCCGCCCCGT
GGCGAAGAAGTGCATGAGGTGGTGCTCGCCCAGGATACGCTGCGAGTGCGCGTTAATGTAGTACGTTTGTTCGGTCTTGTCGACGCAGGTAAAGAGGCCA
GTATTCGGGTCGATAATGTGCTCGAGAAAGAGCGCGAACCACTCGCGGTGCACGCCGCCGGCGTCGACGCCGCTCTCGTCGAGGAACTTGATGCGCATGA
CGGAGCGCATGTGGGCGCGGTGGATCACGGCGAAGGACGAGACCGACTCTTGGTACACGCGGTCGCGGTGGACGTTGAGCCGGAGGTGCGCCACGTCGGC
CGGCACGAGCAGCGCCGCCGTGCTCTGGACGAACGACGCGTACTTGGACGGGAAGTC