Description :
From Genome Similarity Track
Location :
Scaffold_125:58365- 59753
Transcript NameFunction/comments
g14805.t1XP_009523306.1 hypothetical protein PHYSODRAFT_313196 [Phytophthora sojae

Sequence
1388 bases(100 bases per row)
TACCGCAGCACGCGCGGCGGCGTCCGCGGTCTCAGCTTTGAGCAGGCGGTGCTCACGGGTCTGGCGGCCGACCGCGGCCTGCTGGTGCCCGAGGCCGACG
AATTCCCGACGCTGCCGGCCGACGCGCTGACCAAGTGGGCGTCGCTCTCCTATCAGGAGCTGGCCGTGGAGGTCATGGGCCTCTTCATCAACGAGAGCGA
GATCTCGCGCGCCCAGCTTCGCTCGCTCGTGGCCAAGAGCTACAACGCGACCACGTTCCGCGCCGAGGACGTGGCGCCCGTGGTCAAGGTGACAGACCAG
CTGTTGGTGCTCGAGCTCTTCCACGGTCCCACGTTCGCCTTCAAGGACATCGCGCTGCAGTTCCTGGGCAACCTCTTCGAGTTCTTTTTGCAGCGCAAGA
ACAAGGCGCTGCCCGCGGGCGCCCCCAAGCACCAGATCACGGTCGTTGGTGCCACGTCCGGCGACACCGGCAGCTCGGCCATCTACGGCTTGCGCGGCAA
GGAGAATGTGGAGGTGTTTATCCTGTTCCCGGAAGGACGCGTGAGCGCTATCCAGCAGCGCCAGATGACCACGGTGCTGGACGAGAACATCCACAACGTG
GCTGTCAAGGGCACGTTCGACGATTGCCAGGCGATCGTCAAGGATCTATTCGCCAACGCCGATTTCAAGGCCAAGTACCATCTGGGCGCCGTCAACTCCA
TCAACTTTGCGCGCATCCTGGCTCAGATTGTGTACTACGTCTGGGCCTACTTCCGTGCTCGCGAGCAGGGCGTGACGGGCGAGGTCGCGTTCTCGGTGCC
CACGGGCAACTTTGGGGACATCCTTGCCGGATTCTATGCAAAAAAGCTCGGTTTGCCGATTGGCAAGCTGATTGTGGCCACCAACGAGAACGACATCCTG
CACCGCTTCTTCTCCACGGGCAAGTACCACCGCCGCAACATCGAGCACACGATCTCGCCTTCTATGGACATTTGCGTCTCCAGCAACTTCGAGCGCTACC
TCTTCGCGCTGTCCGGTGAGAACCACGACGTGCTGCGTGGCTGGATGCAGGGTTTCGAGCAGACCAGCGAGCTCACGATCTCGGGTGAGCTGCTCACCAA
GGCGCAGAACGAGATGGCGTCGTACGCGGTGCTCCAAGACGAAGTCCGCTCCACCATCGCCGAGTACAAGAAGGTGCACCGCTACCTCTTCGACCCGCAC
AGCGCCATTGGTGCGGCCTCTGCCATGCACTACGGCCAGGAAGCGCTAGCCGACAAGCCCGACTCGGCGGTTGTCGTCGTTGGCACTGCTCACTACGGCA
AATTCCTTCCGGTGGTGTCCAAGGCGCTTGGTGTGGCTGAGGCGGAGATCCAGCAGCACCCAATTCTCAAGTCACTGGAGTCGCTTCC