Description :
From Genome Similarity Track
Location :
Scaffold_111:58358- 61041
Sequence
2683 bases(100 bases per row)
TTGAAGGTTGATATCTCCAAGTACAGAGGAGTCGAGGAAGACTCCCTATTGTTATGGTTCATCGAACTAGACAGAGCCATAAAGGCACGACGTATCGACG
ATGAGCAAATGAAACTCACATTTGCTCAAACCCACTTAGCGGGACGTGCTAAGACTTGGGCCTTAGGGCTGGAGATGAGCGACCCATATGCTTTTGGGTC
GCTGGAAGCCTTTAAAACTCGACTCAAACAGACGTTTGAGCCGCCACGGGCTGAGTTCAGGGCTCGATCAGAGCTTCTGAAACTCAAGCAGGGTAAGCGT
GATGTGCACGCTTACGCTCAACATATACGACTCCTCGCGAGTAGTATAATTGCTAACCCAGTCCATGAACACACATTGATTACTGTGTTCATGCAAGGGA
TCGTAGATGGGCCCGTCAGGAACCACCTGTTCCGCTTAGAGTTGGATACGCTTGAATAAGCAATCTCAGCTGCGGAACAGGAGGACTTTAGCATGAGGCA
GGCTCATGCTAGCTCGAGCTCTTATCGTCCACCGAGACGAAAAGAGACTGGAGGTTCAGAACCAATGGACATCTGTTATGTTGATAGCGAGAGACCTCGC
TCTTCAAACAACAAGCGATTGCAGAAGTGCAACCGTTGCCAGAAGTTGGGACACTACGCTTACGAGTGTAGTGCCCCACGCCCAGTACCAAACAATACTG
AGCAAAGTGATCGGCTATTTACCAAGAAGAGCAATGGGCGTAGGTCCAACGCTGTTGCGAAGTCACAACAGCGTATCGGAACGTCCGAAAATTGTCGGGG
TCAGTAGGGGCGGGGCGCCCTACTGATTCAGCAACCTCAAGAGAATTTGCAAATCTCTTGACGAAAGTTTCTCCAGATACACAATCATTGTGTGTCTCTG
CACCTGGTGATGAGATATCACTCATCACCTTGGAGTTGCAAGTGACAAATGATTTGTCACTTCTTGCCCTAGTTGACTGTGGGGCGTCGAAAAACTTTGT
TCGTCTTCAGTCACTAGAGGGTCGTAGGCTCAAATTCGTTGAGTGCGACATCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC