Description :
From Genome Similarity Track
Location :
Scaffold_26:58358- 59833
Transcript NameFunction/comments
Physo_133410Glu/Leu/Phe/Val dehydrogenase, C terminal

Sequence
1475 bases(100 bases per row)
GCACACCACACCGCACTTGTTGGCCGAACTGTCCTTGACGATGACCACACCGGCGTTGTCGAACAGCAGCTGACGCGCCTCGGGCGTGATGAACAGGTTG
GCGCCCTCCACGATCAGGCTCGACGACGGCTTTCCGTCCGCGTCGAGGTAGTCGCGCCAGTTGTGCTCGTTGATGGTGTTGGGGCGGCCACCAGCGGGGA
TGAACAGGTCGCTCTTGACGCGGTTGTGCATCGAGTTACGAGCGCGGATGCCCTCGGCCGTGTTGATGTCGTGCTTGACGCCCGTCGCCGCCGAGATCTT
GGTGGCGTCGAAGCTGGACAGCGGCAGCGACTCGTCCACGAGACGCAGCAGCTCGCCCATGTCGAGGCCCTGCGGGTCCTCGACCACACCCGTGCCGTCG
CAAATGCCGACAACGCGCAGGTTGTTACCGTACTCGCGGTGCAGGATCTTGATCACATTGCCAGCTACATCGCCATCAGTTCCGCCGGTGATCTTCACCG
TGAAGGGCTCCTTGGTGGGGTCGATGTTCTGCGAGCGCAGGGCGACGTCAGCGAAGACAGCCACACCCTCACTGGTGACACCGTAGACCTTGTGGTTGAA
ACCAGCGTCGGGCTTGGAGCTGATGAAGGCGCGCGGCACCGGGTAGCCGCGGTCCGCAGCACGGTTCGTCATCCACGTGATGTCTTCGGGGATGATGTTC
TCATCCGGGCCAAGGTAGATCAGCTCGTCCTGGCCGTAGTAGTCCACGACCTTCTCCTTGACAGCCTCGTCGGTGGTGTTCAGGTCGAGCAGCGCGTCTG
AGAAGGCCTTGACGCTCTTACGGATGATAAAGTCACGCGGGGCGACATCGCCAACGGGTCCGACGATGGGGTCGCACAGCACCACAGCCTTGGAGCCACC
CTCCGGGATGTCCTTGTTCTTGAGCTGCTGGGCGAACGCGAGGTTGTACGCCTCGTTGTACTGGCGAGCGCTTTCGAGCGCGTGGGCGTCCGTGGAGCTG
GGGTACACCATGCGGAGACCACCGCGAGCAATGTCACGGAAGCGGACGTGGAAGCCCTTGAAGCGACGGCCGTAGATGAAAAAGACGCCGAAAGGAGTGT
CCTTGCCCACGGTGCCGTAGCCCATAACCTTGGGGTCCATGCGGAGCGACAGAGCGTAGCGCTCGCGCACGAACTTGTTGGTGCGGAGCGTGCCACGGAC
GGCGTCGGCCATGCTGTTGAGCAGCACGATGGCGTCCTCCTGCTCCACGTTGCGGCGGACGTCGGCCTTGATCTCGTCCACAATGGCGTCCTGCTCGGCG
TCGGTCAGAGCCTGCTGCTGCGGGTCGAACTTCCTCAGGAAGAAGTCCGAGATACGCGAAGCGAACGGCAGGTGCTGCTCGTGCTCGAGCGTCTCCATGA
TGCGGGTCAGCGAGTACGCGAACGGGTCCTTCTTTGCGAGAACACCGTGCAGCATGTTGCCGTAGGCGTAGATGA