Description :
From Genome Similarity Track
Location :
Scaffold_138:58351- 59841
Transcript NameFunction/comments
Phyta_totarag4376hypothetical protein PHYSODRAFT_508417

Sequence
1490 bases(100 bases per row)
CCGTTACAGCTTCAAGATCGACGTACGTTCTTGTTccgctgattggctgagaaGGCGCGTAGTCATTTACTAGCCAATCCGGTCGAGTCACGTCGCGAAA
ATTGTATCCATCGTCTCTGCCCCGATCAAAAACGTGTACTTGAGTGTATGTGTCCTTCCACTGGAAGTTCCAGCAGCCGAGAGGAGCTCCTGAAACGAAC
ATGGCACTTCACGCTCACTTCTCGGCGAGAAATTCTCGCTCACCTCACTCCGCAATTTTCTCGTTGGATCTCCAACCTCAGGCCAAGCCAGCACGATGGG
AATCACCGACAAATCCGACCTTCCGCTGTTGCAGCCACGCACCAGCACACTCCTCAACGCCCAGCAGACTTCAACATCGCCATCGCTGGTGCAATCGACT
TGGGAGACCATCCGAGCCGAccgcttcaagctgctctCCGTTGGCTCCGTAATCGGCTGGATCGCGCTGggcagcttcgtcatctcGGCGGTGCTCGCAC
CCAAACAACTGGTCGACTACACCCACGACGGCGTGTCGATGCACGCAGTGCACGACCAGCTCGACTTGATGGCGGCATGTGCATCCACCGGCAATGAAAA
AGGTGAGGGTGACGTCGCGGAGATCCAAACCAACAAGGGCGCCGGGTGGTTCCTTGGTGGCAACGACCCCGAGCACATCCTGGCGCCACTACCGGAAGTG
AACTCGATTGATGACCTACCTGAACACTGGGATTGGCGCGACTACAACGGAACGGGCATCAGTCTCACGACTAGCGTGTTGAACCAAATGGTTCCGCGTG
CATGCGGATCTTGCTGGGCTTTCGCCACAGTCAGCGCGCTGTCGGACCGGATCCGCATCGCGCGATTCAAGAAAACTGGCCGCCTAGATAcagaggtgct
gctgtcgccgcaaGTTTTGCTCGATTGCGGAATGCGGTCTTTCGGTTCGTGTCACGGTGGAGACCCGCGATACGCACACAAGTGGATCCATGAGAACGGC
ATCGTGGACTTGACGTGCAATCCGTACGTTGCGTCGCACCCGTCTTGGATGGGTGGTGGGGACTGTGCTGCAACACAGTGCCACACATGCAACCTGAAGG
GCGAGTGCTTCGTGGTGGAAGACCCAGTTAAGTACCACATCTCGGAGTACGGCACACTCAACTTCACGACGTCGGAGGAGTTTCAGGTCGAAGCAATGAA
CGAAATTTATCACCGCGGTCCTATTGTCGTGAGCATGTACTCACTGTCCCCGGAGTACCGTCAATTCAAGGGAGGCTACATCCTTCGCGACTCAACGAAG
TATCCCGGTACTACCCACGTCGTGAGTATTGTTGGCTGGGGTACCGACGCCAAGACGGGTGTCAAGTACTGGATAGTCCGCAACTCGGACGGCACCAACT
GGGGCGACCGcggcttcttcctcgcagAGAGAGGTGTGAACATTTACAACATGGAAGGCCGCGGCGCGTGGGCTGTCCCTGTCGTGTAGA