Description :
From Genome Similarity Track
Location :
Scaffold_493:5835- 11377
Sequence
5542 bases(100 bases per row)
CCGTCGAGGTCTCTAATCGCATTCGTGAGAATGCGCCGACCCCGATATTTTTTCTGCCGTTGAGTGCTTCATAGGGGATTATGACACATGCCATCAGTTG
GTGATGTGAAGGACGTGACAGTTGTTGATGTAACAGCTGGTGATGTAATAGCTGGTGATGTGCAGGGTGTGAATAAACATCCAATGAAGCCGTTAGTTTG
AGCACGTAAATCCTTAGCTCTTTATATTACACTCTCATTAGCAGCAACTCCGGAAGCCTTTCTAGCAAGACTTTCGGAGCCGATAGCCTTTTTGCTAGCC
AATGGCGTGTCATTTTGGTCGATTATATTTGAATCGGAATCACTATAAACTTTCGAGATCAGACGGTTCGAAGGGACGACCATTGTCCTAAAATGAACCC
AGGGCAGTGGGTTGATTCCAAGTCAACAATGTAGGATACGGAGTTTTGCGAAGAATATAAAGATCTAATGGACTTGGCAGCCGAACTGAAGGATTTGCTT
CTATATCACCTCGAACTGATGTATCAAGGCGCAACCTCAATCTACTGGTAAATTATCGCCATTTTTATAGTATTCATCTGGGTCGGATGAGGTTTGATGA
TTACGCGCTGCCATTGTCTCCGGACTACAAACCTGTGCAGCGAAGCGGACCACCTTGAGCATCTTCGATTGTTTTTTGATCGTATGATCACCTTTGGTGT
AACCCTAAATGGTAAAACGTGTCATATGTTTCGGCAGAAAGTGGACCATCTCGGGTATACACTGGCAAAGCCTAATGGAGGATTGCGACTACTAATTGAC
TATAGAGTGCTTAATCGCTGGCTCGCCGCAGTCCGTATTTCTTTCCTCGAACTCGCGAGATTTTGATACGTCTCGCTATAGCCAAGTGTATATCGACACT
GGATACCAGCATGGTATAGTACGCAAGGAAATTGGCGACGATAAGTAGACCGCTTACGGCTTTCTGTCTACCGTTTGGTAAACTCCAGTACAAGCGCCTT
CCAATGGGAATAGCTACCGCGCCAGACAAATATCAAGCCTGTATGGAGCGCATTTTCGAGAATTTAGAGTTTGTCGTCGTGTATCTCGACGATCTTCTGG
TGTTTTCAAGCAGCGAAACGGACCACCTTGAGCATCTTCGATTGTTTTTTGATCGTATGATCACCTTTGGTGTAACCCTAAATGGTAAAACGTGTCATAT
GTTTCGACAGAAAATGGACCATCTCGGGTATACACTGACAAAGCCTAGGTGATATATTGATACCAGCTACGTCATGTACTTCCCTGTATAAGGTAGAACT
ACTACTGACGGTATGCGACCGACGGAAATTGTTGATCAGCTAGACCAACAGTTTTTGGGGACGGCGTAAGTGGATTACCTGGATCATCAAGTATCATTGG
CCGGGTTGGAAGCTAATCCTGAGGATCTAGGATCGCTGGTTAACATCTCCTTCCACGAAACGTTGCGTTCCATGCAATCTTTCTTGGGTAGTCTGAACTA
CTACGGTCGCTTTAATGAAGATTTTGCAGTATACGCATCTGTGTTGTACGGGCTACTAGAAGCAGGTTTTTCTAGATTAATCATATGGATGATTGTGAGG
CGATAGCAGGAGTTCGCGATCTCACCCTACAAGGAGGTGATCCTGACCTGAACGAAGGATCTCGGTGGGAAAAGGCCACTATCGCATTCACTCTGTTGAA
GGCCAAGATCGCTACTACCCCGATCCTCAAGCACTTCGACCCAAATCAACTTCGAGTGATCGTGGTATATGCTAGCAAGTGGATAGTGTCGGCATCCATG
CTGCAGGAGTATGATGGCGTATACTGGCCGGTGACATTCACGAGCCGTACACTGAAGCCGATGAGATTAATTCTGGCATGGTGGAGAAAGAGGTGCTAGC
CTTGCTTCGGATTTTGGACGTGTGCTATACTATGCTAGTATCCCGGGAGCAAGATGGGCTCACTCGAATTTGAAGCTGATACGACGTAGTTATCCGTGAC
CACGTCTGGAGTCAGATCGAAGACGATCCCGTTGGAGAGATCGAAGTCATAATCCCACCGAAGCTTCCACCCATGTGGACCAGAGTCTCGACAGCCAAGT
GATCACACTCGGACCACGGCAAGGTGGAGGTGTCTGAAAAGCAGGACTGGCAGCTGTCGAAGTTCCGACGTCCGAAGTTGGGATCGGGGGGTGGGAGATC
CGAGAGGCCTCGGTTCCGAGTTGGGATTGGAGACAGGATTCGAAGGAACGTGATCGGCCATCGGAGGGAGACGGAGAAAGTGGGAGTGTGGTATGTCGGT
ACTAGTCACAAGGTTGCACAATCAGATCAACACCGTATGTCGACAAACGGTGCAGGGGACGGTTATGGCAAAGCGGCCGCAAGGAAATTTCCGGGTTGAG
TTGAAGTTGGGACCGCACAGATTGCACGCTTCAGTTAAGTCGAAAGGGCTATGATTGGCGGACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGACTCCGCCACTTCATGGCTCTGTGC
CTCGGACGCGTCCCATCAGCTGTCCAAGCACGAGCGCTTTCAAACTGTCTCAGTTTTGGAACGTGTTGCTCTGGTGGGCAGCTCAACAAACTAGCCAGGG
ATTGGTCGCCAAGTCCCTAAGCCGTATGTTCAGCCACCTCTCTCGAATGTTGGGAGAGGTGGGGAAATTGGGCCCAATCAACATTGAGACCCATCCTCAC
TGACACGCTCACAGGAAGACGGGTCGTAGGAAGGACTACGAGTGCTACCAAGTGTAGGCGAGCTCTTAAAGCTGCCACGCACTACCTCTACACACAACTT
CAGGCACCTGCGAGGAAGCGGTTTTACTGTCTTCTCTCGCTTGCAGCAAGGTTCGGTTGGGCGTATTACGACTGCCTCACCGATAGATGAACGCTTGTTG
CTTCGTGTGGTGCGGACGCGGTTTCCCGCCCTCCATCACACACAAACGTACATTTCAAATGAAAGTCTAATTTCTATTTAATGAAATAAACAGGAATCTA
AATGGCTATTGGCTAAGAGGAAAAAGATTAGACGTGCGCTCTGATGAGGAGCGGTCTCTACAGCGCGCTTAAACTGAATGCAAGCGCTTTGATTGCTTAC
TTCAATGATATCATGTAATGACGTCAAATAATGACGCCATTCATGTTTGTGACACACGCTTTTGTGGTAGGTACGCAATTGCTGTACCATACCCCATAAA
AGGTCTAAGTGCCTACCGCACTTATAACCTTTCTCAGATTTTTTCGTACCTTTACACGAAAATTCTCGGGTAAAGTTTCGACCCCTATCATCTACGATAT
GGATCAAAGTGTATGAAAAAAAGATCGTTAGCAAAATTGACTTCTTTGTGGTGTCGAAACGAATAGAAAAAGGCGTACGCACTCCGATCATACGCTCGGC
CGTTGGATGCAGGAAACTAATATCTTCTGTGCTGCCAAGACCAGAGTTGTAATGGGGCACTAGTATTTCTCTGACACAGTACAAGTTCCTTCGCTGACAT
AGTACTGTGCCACGCGTCACTCCACGTAACTGTACGCACAGA