Description :
From Genome Similarity Track
Location :
Scaffold_25:583472- 586154
Transcript NameFunction/comments
Aphas_H257_09768predicted protein
Aphas_H257_09769TonB receptor activity

Sequence
2682 bases(100 bases per row)
CGACAATGGATGGTGTATTTTTTATTGGCTGGTCGCCCTCTGAATCGATGTATCGCCTCGTTGCTGGAGCCTGCTACAGTAGCTTAATAAAGGGAGTTTG
CAACTCACGCCACTGCGACCGCGGTCCCACGATCGCACGAATAAGATGCGGCTCAACTCGGAATTCAGGAGTTTTGAACGTGTAGGCTAACGGCGACAGC
GTCGTCCATACTTATCTGGAGATGGTAAACGACGCAAAAATCGGATTTTGTCTTGTCCGCCAGTTCAAACTACCCATAACACATGCCCCCCCCCCCCTCG
GTCCGTGCCTATCTATCGAACAGCCATAAGTCGTCCTGGAAAGCTACATGCAAAACACGAATATGATATATGTGTGTACTATATTCAAAGTTCCAACGGC
GTCGCTGGTTCGTACCCACGCACCAACGAAACGACGACAGACCCTGCGATTCTACGTGCATGTTGACATTCTTATCGTTCCAACCAAAGTACTCCATTAC
CCGCAGACCATTATTATTGCATGGGGTAAAAGGGGAAACAGTCGTCCAGCCAATACAGGTGTTTTCGTTGTGGATACGGTGAACACTATCGAATCATCAT
CGTCCAGCAAGGGGAACCGCGATGATTGAAAAGCCCACTCATGTAGCACAACGCATGGTGGAAAATATGGAGCTGGCGTACGTACTATCGCGCGATTATA
AGGACGACATTAAAAGCACATCGAGAATGTCAACGCTGTCGCAGCCCCAACCGACACAACCGAAAGCATCCGCGTTACTGCCCCCCCTGTCGTATTGGAG
GGAATCGAGGGCCATCTGAATAACGTCGGGGGGGGGCCAGGAGGAGGAGGAGGGGAGGCGGTTGTTTTTTTGTGTTCACGACGGAGGCGTCGACAAACGC
CGTACGTTCTCGCGTGGGCGGGCTTGGGGCACCCGGCCCACGCGCACATTTTCTTGTTCGCACCATGCTGGAAGCAAACGTTGGCCACTCGGGCCCGAAG
GGTGCAGCCAGGGCGACATACGTTTTTGCCCCCGTGGCCGGCGCAAAGTTGCCGAGGGCGTACACTTGGTTGCGGCACGCGTGGACTTTTGCAATGTCGA
CGATATGCATGGAGCGCACACTTGGACGAGGGGGAGGCACGGGGAGGTAACAGCCGGCAAAAAAGCATGATCGTGTGATCTCCGTACGTAGTCAAATGAA
TAGTGCAATGCCGGGGAATGTTCCTGGATTCATTCGTGTGTGCCAACAATCCAGTACGTACTGTTGTACTCGGTGTCTTTTGCGACCTGCTTCGGGTGAA
TTGTTCGGATAAAAACAAACGCAGAGTGCCAATTACGCACCGTCACGACTCTTAAAATAACGCCATGGAATCGTACCTATGTCTTAAACAAATGATAACC
CAAACTCAATTAACCATGGAATCGTACCTGCCGCTTCGGTTGCTCTGGATAAAGGTACTGTACATGTACTGTTCTGACGTTACTATTAATAGTATTAATA
ACTGTACAGTACTCCGGAGTATATTCTTCGACGGGTCAATTGTGTTCGAATTAGGCCGTCCTACAATTTACTAGTAACGTTAGTACTCTACACGAGGTCG
CCTGGCCGTACAGGTACATGTAGCTAGCGCTTAGATACTGTATACTTGTACATTTCGTGTCATTGGACCTGCGTAAGATACGTACTGTACTCCTTTCTTG
CTGTGTTCTTGGCCCCTGCAGTCTGAACCTTCGTAGTACCGGTACTATAAATACAGTATTACCGTACTACACTGTACTACCACTTGTAGCTAGCTTGTAC
TACTGTACTAGTACATTGCTGGTAGTACTGTATTGGGCTGAAAACAACGACCATACGTAAATTGCCTGAAAATCTTTACAGTCACTGTCGTTCAGAGTTA
TTGCCCTCAAGTCGAAAATTCTCGGATGAGTTTTGTACAGTACGTACAGCACAGCACAAATGTACTTCGAAGTAAGTTTACTGCTGACATGGACATCCTT
AACGAGTACTAGTACAATCGACACAATCAAGAACAAGTGTGAACCTGTGTCCCGTGCTGTCCAAACCCCGGCGTCTCCAACAATGGGGCGATTGGATTCA
GGACGCTGCTGCTTGGACAGAGAACATACCAGTATGTGAGAATTTCTCTGATTGCACCGGCGCAATCGCATCTTCATATTGCAATCCTGTCGAACGTACC
ACGTACATATGGCAAAGTAGCGTCACAGGCCGCGTGGAAACCCCCACGTCCTTTTAGTACCATACTAAGGCAGACTGCGTTTGATTTGATGGTGCAAGAC
AAGAATGCACGAGGAACCTGCTAGAGTTTGGTTGCCAAGAAACCAGGGTTTCGACAGTGTCCCCCACGAGATGTGTATATCAATCGGCACAGTGTACCAG
TATACTACGGTAGTGGGTGTGCGACAAGCTACGCGGTACAGTGTACATACATCCTATACGATCTTGGCTTGGTCCCTTGGACCTCGTGTACCATCAGAGT
CAACAACAAGCTCGTTACTTTGTAGTTCCTAGTATTAATAGTATATAATCTTTATAACGTAGCCATCCTTTTCATAGGTCGTCCATGAGTTCAAAAATCC
CCCGCAACATGCTCGTGTCGTGATGGTAATGCAGTGGGTCCCACCGCTGCTGCTGCAACGGGGCAACCGTGTGATGGTTCAT