Description :
From Genome Similarity Track
Location :
Scaffold_85:58334- 62045
Transcript NameFunction/comments
Phymu_g3849hypothetical protein PHYSODRAFT_543861

Sequence
3711 bases(100 bases per row)
ATGGACTCGGAGGGCTTCACGTCGCGCGCGTGGCTGGGCCACTGGGTCTCGGGCGAGGAGGAGCCCGTGAACAATTACTACGAGGACCACAAGCTCATGG
AGGGCGCACTCATCAAACTGGGCGACTACGCGCACTTCCGCtacttcctgctcttccgcAACGGCCGCTTCTGCTACTACGAGCTGCCCATGCCCGCCGC
AGCGCCCGGAGGGGGGCCCGAAGGCCCCAGAAGGGTCCACCTGACGCTAACATCCAAACACTTGCGTGGTGTCATGATGCTCAACGCGTCAGTGAACGCC
AAGGACCTGGCCAAGAGCGAGGACGAATACGACGCCGACCTCATCAAGCGCGGACTCGTGTTCAACCGTAAAAAGCTGGAGATGCAGCTCACTGGCTACT
CCCCTACCGGACAACTCATGTGCTGGAAACTGCGGGCTGGCAAAGACGCTGTGTACCTCAAGTGGGAGCGCGCTTTTCGTCTAGCACTGCGGCCGATTTG
GGTGCAGAACTCCAAGTGTTGCATGGTCTGCAAGAAGGAATTCAGTTTCTTCATCCGCCCGCACCACTGTCGGTACGTTTAGGAATTGGTAGGACCCTTT
GCAGAGTGAAATCATTGACGTGTTGTCTGTTTTTACAGCAAGTGCGGCACGTGTATGTGCGACGAGTGCTCCGTGTTCGTACCACGACTGCCGATGCAGG
GCTACTATGACGAAGTGCGAATCTGTCGGGACTGCTCGCCTATTAAAATCCAACGCTCGTCCTTGAAAATGGGCACGCGCGTGCTCGTGTACGGCGTTTT
GGTCGGCAAAGTGGTGCAGGTGGATGCTGCAGATGACTCGGCGGACGGAAGCGCCTTTGTGAACGTAGAACTGGCAAAGGAGGACAATCAACTGCGTCGG
TTTGCGCTGGAAcacgtggagctgtactCCGATGCCGTGCTGTCCGCCAACCGCATCAAGAATGCCATCCGCCAGCACCTGTCCTACGCTGTGTTTCGAA
CACaactcaacttcaacactTGGAACTTGCTGGAGACCGTTCAAGAGCAGCGCACAGTGCAGATGGTGCGAATACTTAACAAGTCGACGAGTATCAACGA
ACTGCATTCGATGGTACCGATGCTCGGGTCATTGGACACGATGCAGTTtccggacgacgacgtctcCGAAAAGGATCGCGTGAAGGAATCGCTTTCACAT
TACCGCGGTGTGCATGTGTGTTTCCCGTTGCGGCTGGATACAGTAAAGAAGCTCATCAACCAGTTCCGCAATGGCATTTTGCTCCACCGCGTCTTCGTGC
GCCAAATCTTGGACGAATCGGAGAAGCTATTCCGGAAGATACACGAGTCGCCAATGAACGAGATCGAGATTCCGATGGGCGTACAGTTGGTTGTGGTGGG
CGATCTCCATGGCCAGTTGGAAGACTTGCTTACGATCATGGACAAGAACGGCGTGCCCAGCAGTAAAACGTGGTATCTCTTCAACGGCGACTTCGTGGAT
CGTGGATCTCACGGGGTCGAAGTCATCCTACTCCTGCTAATTTTCAAACTGCTGTATCCCGACTACGTCTTCTTGAACCGCGGTAACCATGAGGAACGTA
TGATCAACGAAGTCTTCGGGTTTGAAGATGAGGTGTACACGAAGTACGGCACGGACAACGACGAGGTTGCTGGGTGGAATGGTCTGGGCACTTCGACGAA
TTACTCGCCGATGAAGCTTTTCCAGATGTTCGAGACCGTTTTCGGTCTATTCCCGATCTTTGCGTTGCTTAACAAGCGTGTCTTTATTGTGCACGGCGGT
TTGAGTAACCACGAAAACGTCACGATCgaggagcttctccagcttgacCACAGACGTGAAATTCCAACGCAAGGGACGAGCCGAGCGGACGAGGTTTTCA
CGCATCTTTTGTGGAGCGACCCGCGTGACGAAGGCGGATGGAAACCGTCTAGCCGAGGTGCCGGCGTGGAGTTCGGGCCTGATATCACGAAAGCATTTTG
CGCACAGAATGGAATCAGCCTCATTATTCGGTCACATGAGTGCCGGGAAGAAGGTTTTGACATCGTTCACGACGGCCTGCTTCTGACGGTCTTTTCAGCG
TCAAGCTACTGCGGCTCCCAGACCAACAAAGGCGCCTACGTTCAACTGGAGTTAGGAGAAGACAATGAGGTTAAGCCGCATGTGGTCCAGTTCTCCTCTC
AGCCTCTCCAGAAACTCAAGGATGCCGGACGAAATGAATGGCGAAAGAAAGCTCAGCGGTTGGAGCGCAGGACTTTGATGTCCCTCGTGGAGATTATCTG
TGAAAAGAAGAACGCGTTGCTCTCTGCTTTCAACGCGTTGGATACTGCTGGCTCTGGGCGTGTCTCGAAGTTGGAGTGGAAAGCGACTTTGCAAAAAGTG
CTGGGTATTGAGGCGAGTTTCCTTTCGTATTTCCATCAACTTGCTGAAGAGGACCAGGATGGCGGTGTCGATTACCAGAAGTTCCTCAATCGCTACACAG
TTGAGCTGGATGGCGGCAATGTGGAGTGGAGGCGCAATCTGATCCGCAAGGTCTGGATGGGGTTCTGCCAGGCGCTCCCGCACCCGCCTGAAACAGTTTC
AGAAAAGATGACATTGCAGGACAAGCTGCACCTCGCGTTTAATTTGTTCCAGTCCTCCTCGCCTGGGGCTGCGAAGAAAGAGCTCCCGTCAACGCCCGTT
TCGAGGCCCGAAATGGCCGGGCCATCGAGTAGTTCCTGCAATGGTGACAAGTCGAAGGAAAGTTACCTGCGCAATAGTCTCGTGACATACGAGGTGTTCC
GAAACACCATTCAGGGCAAGCTGCAACTGGGCGATACTCTTTCCGAACAGCAGATCTTCGAGCTGATGCAGCACCTCGACCAGAACCACGATGGTGTGGT
GGACTACCAGGAGTTTTGCTCCTTCTTTGCCGAGTTCAGCCGGACTGATTATCTGCAGGAAATCTTCGAGGTGGACGACACGAAGGCTATTTCGCTTTTG
AACCGCTGTGCCACATTGCTGCAGAGCCCCAATAAGTTCAAGTCACTACGGGATGCGTTCGACGCATTCGACCACAGCAAGACAGGAAAGTTAAGTGTGG
AAGACATTTGGAAGGGGACACAAGAGTTGAATATGGTGCCCGAGTTGGACAACGAGGAAGCGCAGTTGCTGTTCAATTCGATCCTGCTCAGCTACTACGG
CATTAACCAACGGGCTCAGTGGGATACGCGGGGCTTGGATTGGGTCGTGTTCGAGGACACCTTCTCGCCGGACAGCACCTTCCAGCGACGTCTGTGGCTG
GCAAGTCTGGGTGCCTCGAACACGAAtctggcagcgctggacgTTCGTGACTCGCTGtctggagacgacgacagcgacggaTCGGCTTCGAAGAACCAGG
CGTGGGCGGACACGTTCGTGGACAGCGTCAAGCAGTCGCTGCACGAGCAGCGTCTGTATATCAAGTTCCTTTTCCGGATAATGGACCGCAAGCGACACGG
GTACATCACCAAGGAGCAGTTTGTCGCCACGATGCAGGCCATCAACGAGGAACACGGTGCGCCGCTGAAGCTTTCCCAACTCGAGCAACTGGCTGACGCC
TTCGCGCACCGTAAGACCGTGCACCGCGTGTCGAACGCTGgcgaggagacggaggagacgcgAACGTATGTCTCGTACCCTGAGTTCCTGCGCAGTCTGC
GTATCATCGAC