Description :
From Genome Similarity Track
Location :
scaffold_83:58311- 63743
Transcript NameFunction/comments
Pl_110192hypothetical protein PHYSODRAFT_469633
Pl_110193elicitin-like protein SOL7
Pl_110194conserved hypothetical protein
Pl_110195sodium/glucose cotransporter, putative

Sequence
5432 bases(100 bases per row)
CCTCGTTCATTTACCGCCAACAAGAAGATCCGCGTGCTATGCTTGCACGGGTTTCGAACTAACAAGCAGGTCATGATAGACCAAACTCGCGGCATTCGCG
AATCACTGGGAGATTCAGCTGAATTTGTCATACTGAACGGGACGTACGAAGCCCGCGGAACGAGTGACCCGATGATTGAGAATGCGTACAAGTCTAGTGC
TCCGTTCTACGAATGGTTCGAGAACCAATTGGCCGACGGATCTCCGCTGTTGTACAACGATGCCGAGTCTTCAGCCAAAGCGCGTCTTCAAAGTGGTGCA
GACAAAGGAGAAGATCACGCGTGGAGTTTGTCCTACAAAGGAGTCGAGCAATCGATGGTGAGGATCGATGAGGAGCTCCGTCGCCACGGTCCATTCGACG
TTGTCATTGGTTTCTCCCAGGGTGCAGCACTGCTGACGATTTTAACGATGTGGTATCTGTACCATGGCAATGTACGTTGGTGGAAGCTGGTGATTTGCGT
TGGTGGAGTGGACGTGAGTGGTGTCAATGTCAAGTCGCTGTTTCTAGACAAAACTGGGAAGCGTATTCCCGTGCCGTTGCCTTCGATTCATCTCATTGGC
AAGACGGATCCACTTTTCCATGAATCTCATCGGTTGGCTTTGTCTTGGGCGGACAAAGCGGAACCTAATGGTTTCCAGAAGGTCATCTACGAGCACGAAG
GAGGTCACAAATTCCCATCAGTATCGAAGAACCATGAGTTCTACGCCGAGTTGGGTCATATCATCAAGAAACACTGCAACAAGGGAACCGATGTCATTAC
GGCTAAGTTGTAAAAGAGGTGAACTTCTGAGTAAAGAGAGACTGCATTGCAATAACGAACAGCACTGATAAACCTATCGTGTAAATCTGGTGAGAGCAAA
AGGGAAGTATATTCATGCCACGGACTTCTTGTTGAGAACCTTCAAGTCGTGACAAACATGAAATGAAGATCAAAAACAAGTAAGCAAAGGATGAGGACCC
AATGTCATGTTAAGACGGAGCTGCATTCATGTTTTCAATTACTACGAGTTATTTGTCCACATCACTTCACTTGTCGTAGTCGTTGCGTAGCGAACTTGGT
CGCTTAAGCCGAAAGGCTGAGAGCCGTGCAGTTGGGCAGGAAGCTCTCCGCCAGCTCCAGCACGTTGATCGACACCGTGCCGAAATTGATCACACAGTCC
GCTGGCTCCAGGGCCAAGAGGTCAGCGATGAGCGAGTAGCAGTCGCTTGTCAGGCACATGAGCAGGACTTGAGACTCGGTCGGGTACGCAGAAGGAGGGA
CAAACGTGTAGCCCGACGCAGTTTGACACGAGTCAAGGTACGTGTCTCCGGCGAGAGCCAACAGCTTGGCGGTCTCCGATGAGGGACACGCAGAAGTCGA
GTAGGCTGAAGACTGCGTGGCGAGGCAAGCAGCAGCGGCGGCAGCGGCGTAGGCGAAAGTCTTCATGATGTTGGAAGAGGAGTGTGGAGGTGGGGGAGCT
GGTGTTGGAGCTTGGAGGAAGATTGAATAATGAACTCTTGGTCGAGCCTCGAAGACGGAGTGGCGGCGGAAGGTGGCCGAGCTCCCGTCAAACACCAAGC
ACTGCAAACTTTTCTGATGCTTGACTGCCAGTCAAGCATCAAGCGGGAAGCTGGAAGCCTCTGCGTGAGCCGTGTGTGACCATTACCGTCTCATGTGGCA
CTTTTGCTGCGCTCACTTCAACTAAGATGATGTCCTAGTGACTCACATCCTCGGTCCGCCCAAAGCGATCCTATAGATCGCTCTTGTGACTACCGTGGCA
CGACGTAAAGCTTGGGGAAGGTAACTGAGCGACAGCTTCAACATGTTACACCACTTTTGATCTGATCCCAAGTTTACTTGACAATCATTGTCAAGCTGAT
TGCAAACGGGACTATCACTTCCGCCGTTGCAACAAGGTAAAAGCTGCAATCATCATTTCGTAGAGCTAGATGAAGTTGACATTCGAGTTTCGTACGAATA
ACCAAATTCGTTTGCTATGCAAACTTTCCTGGAAGCGATAACTCAATCAATCATGAACATCCTTGTGACCCTCCTTTCCACCGCATCAAACAGACTGGTC
CTCCCGTTGTATTCCACAGTGCTGTATATCGTCTTGTTTGCTAGCAACATCGTGATCCTCAATGCACTGATGTGTGTGCCACGAATCAGCTCATTCACAC
ATTCACGTCGACATCGAGCATACTGGTGTTCGACTGCCGTGCGGGAAAAACTGTTCTCGTCTACTGTCCGTCAATGTGAACAAGTTGTCCTTGACGTCGG
TATCAACGTCAAGTTGAAGTTGCATTGTGTGTCAATTGTGTAGACACAAGTTTCGCCCTATTTGCGACCATTCTTAGATCTATTAGGTATCAGCACTTGC
GGTCATCATGCACCCTATCGTTCACGTTATGATATTTGTACTGCTGTCGCTGGTCCTGCCACACTCAAGTTCTACAACTGTCATTGAAGTGCAACCAGAG
GCACAACCAACTTCTGATTCTCCTGCAATTTCATCTCAATGTGACTTCACTCACTTGCACCCTCGACGATATGCCACCTATCACCTTCCACCGCAAACGG
ATCAGTTTTCACCAAGTATTTCCATTGACGGAGTTCTGGACGAAAAAGCGTGGGCCCAAGTGCCTTGGAGCGAACCGTTCCAAGATATTCGAGGTCCAAC
GTTCTGGTTGCAGCCATGGTTCACCACCAAGTTCAAATTGCGCTACGACCAACGATTCCTCTACGTTGGGGCGTATATGGAGGAAACCGAGGTGTGGGCC
AATGTGTCACAACGTAATGAGGTTATTTTCCATGACAATGACTTTGAGGTGTTTGTGGATGCTGATGGGAGCACCCACAACTACAAAGAGTTTGAACTAA
ATGCTCGAAATGCTACTTGGAACTTGTGGCTCAATCGTCCGTACCGAGATGGTGGCCATGAAAACAGTACTCGTGTGGATCCCCAGCATGGTTTCGATAT
GTTACATAAGGGTATGCGCTCTGCAGTGTTCGTGAAAGGACAAATTAATGATCCATGTACGTCTGTAGGTGCAGATTTCCAGCGTAATCGTGCCTAATTG
CGTTGATGTCATTTGTAGCCGAGCGTCTACACTATTGGACTGCTGAGATTGCACTGCCATTGTCTGAACTGGCACTACATTCAACTGCAAAGGTTCCTCC
AGTGGCCAACTCATTTTGGCGGATCAACTTTTCACGTGTCGAGTGGCCTGTTCGCACAGTCACGGATGGAAACACTGGCAAACAGCGCTACGAAAAGAAA
ACGGGATTGAGCGAGGAGAATTGGGTTTGGAGCACACAATATGCTGTGGATATGCACCGGCCAGAGTGGTGGGGGTACCTTCAATTTCGGCCACAGAGCG
AAACTCCACCCGAAGGAATCGACGCTGAAGACTTGGTGCCACTCGATCCTGAATGGGGGGTACGCTATGTGAGCTTCCAGTTTTACTACGCCCAGTGTGC
TTTCCACAGCACAACGGGGACATACACATCGAGTTTGGAGAAGTTACTGCCGTATTTCACTTCACGCGAGGCCATTCAGTGCACCAAACTACTTGACATA
ATCGCCACGGACAAGTTGTTTAGTGCTGAGATCGGGCTAAGAAAGAACGCAAACCGCTTTGATGGTGCTTCCGACTTCGTAGCAAGCATCGAAGAAGACG
GATACATCACTGTTGAAAAAGTGAGTTATCCGTCCGTAGGCGTTACTATCAAGTGAGTGAATCAATTAACCAACGAAGGCATGATTTACAGTGGAAAGAG
GCTTGATATTTGAGATTTACTACATGGTGCTTCACCGAAGCAACCGCACATACGTACAAATTCCTTTTGCTTCTTATGCGAAGTAGATCCACATGCTGAA
AGTAATTGCAAGAGCAGCAATACCACTGCCAGCGACGAGAAAGTTAACCCACATGGGCTTGGCGAGTTCCGTGGCGTCAAGCTTGAGGACCTTGTCCCAG
TGGACCATGTACTTACGCACCTCCTCCGACGGGCGGCTCTTGTGCTGTGTCAACAAACTCACCACGACACATACTACCATGGCAGTGACCCAGAGCAGCA
GCGCGAAGTGCTGGAAATTCATGTAGAAAAATGTGTTCCAGAAGGCTGGGAGGTCACCGTCCATGCTGTCATCCTTGATCGTCACGAAGATAAGACGCGA
GAAACCCAGTAGACCACCCACAATCATAGCTGAGAAAGCACCGTACACGTTCGCCGGCTTCCAGGCAACACCGAGCACGAGTACGATGCCAATGGGAGGA
GTGAGGTAACTCTGAATTTCTACGATTTGTTCGTAGAGACCCGTTCCGTTGCGCATGATAGGGATCCAACAGAAACTCAACACGGCAAATACCAGGATAC
TCATACAACCGACCCACACGAGCTGCTTGTGCGAAGCGTCCGGGCGGAATTTGAGGTAAATATCGTTGGTCACGACCGACGAACCAGCAGCAAACACAGA
TGCAAGACTCGACATCATAGCGGTGATGATACTGGAAATCATTAGACCAATAATTCCGTGCGGCATCATCTCAGTCAACAGAGTCGGGTACGCGGCATCG
GTGCCATCGTCAATTTTGCTGAAGTCGAAGTAATAATGCCTGGAATGACAATCAGGAACGGAGGAAGTACCTTCAACATACTGGCAAACGAGCAACCCGC
TTTCGCGTTGGCCGTATCCTTAGCGGACAGCACACGTTGAACAAGATCCTGATCCATACACCAGTACCAAATCGACCCCAGAGGTTGACCGAAGATCATA
CCTGTCCACGGATAGTCAGGGTCGTCCGTGGGTTTCCACAGGTGGAACCAACCAGAGCGGTCCTGATTGTCCAAGTTCTCCTTGATGCCTTCAAACCCAC
CGATCTGGTTCACGGAGTATGCAAACACGACAAGACCTCCCAGAGTGAAGACACACATTTGGAAGAGATCCGTGTACATGACAGCACGAAGACCACCGGC
AATGCTGTACATTGCACTGAGGGCGATGCAGACACCGGCACCAAGGTACAGGTTCCATCCCAACGTTGCTTGGAAAACGATGGTTCCACCATAAATACTG
GCAACACATACATGATGACCATGATGAGTGACGGCATGGAGCACCAAAGCGATATTCGAGGAACTCCGGGGTCGTGTACACGCCGCAACGACGGTAAATG
GGGGAGAAGATCCAGCCCAAACACAAGATCAAAATGGCAGCATACCACTCGTACATGGCCACTGCAATGCCGCGACGGGCTCCATCACCGGCCATACCAA
CAAAGTGCTCAGCACCAATGTTGCTTGCAAACAGTGCACCACCGACAAAGTACCATTGCATACCGCGATCGGCCAGGAAAAAGTTGGACACCTCGTTGAC
TTGATGTGCTGGTCCGTCACGCGCAATCAATG