Description :
From Genome Similarity Track
Location :
Scaffold_1:5830481- 5850757
Transcript NameFunction/comments
Physo_553647cysteine protease family C01A, putative
Physo_248465Mitochondrial Carrier (MC) Family
Physo_355165AlNc14C162G7799
Physo_310834flagellar protein, putative
Physo_29551250S ribosomal protein L13
Physo_295513AlNc14C143G7331
Physo_248380dynein heavy chain

Sequence
20276 bases(100 bases per row)
TCTCACCTTCACGCTTCAATGGTTAACACCGCTTTATTCTTTTGGATCAAATAGGAAGGTACATGAGGTCAAAAAGCGCTAATGTCGCCATGACAAAGTG
GCCTTCGTGGTCCCGTCGCCATGCGCTGCGAGCCTAGCGCGCCGCCGCTTGGGCGTTGTTCTGGTTACGAGCCGCGTACATTGCCGAGTTCTGCTTACGG
ATCGTCTTGAGCTTCCGGTTCGACACAAGCATGCCGATGGCCGTCGTCACCACCGTGAAAATAGTCGTCACGGCTGCAACAGCGATCCACGCCGTCGGAC
TCAAGCCCACGAAGACCTTGTCACCGCCGCTGTCGACGCTGGTACTCGCCGCAGCGCCAGCCGAGGCACCCGTGGGGATGACGGGGAAGATGTTCAGGCC
ACAGTTCACCTTGGCATCGGCGACCAGCTTCATGAAGCCGCTAGCGCCCCAGGAGCTGCCGTACGAGTTCTTGAGGATCCAGTAATCACCCTCCGTAGCA
TCCGTGCCGTATCCCACAAGCAGCAGGGCGTGGTTCACGTCATCCTTCGAGGACAGGTCGCCATTGTTGGGGCAGCTGTAGAAGCCACCTGCGTAGTCGC
CGAATGGGTCCTCTGAGTTGATGGCGACGGCAATCGGCTGCTTCTCGAGCGCAGACCGAAGCAAGATCGTGCAGTTGCTGGATGCCGTGCAATCCGCGCC
GACAACTTGTTCCCAGCCCGTGATGCTGGCAGCCGTTTCGTTAGCGCTCACAGAGCACGCTGACGAAGCATTATTGGACGACGTACTGCTCGAGCCCGAG
TCGTCGTAGGGCATCGTGAGCTCCGTCACGAGACCCCACCCGTTCTGCGCGGCATCGATGAAGGCGCCGTGCGTCATGCCACCGTTGCAGCCGTTGTTCT
GTGACTCCCACTTGATCTCCGTCTCCATCCAAGTAGCGCCATCCACGCCGTTGTCCGAAGCCCAGCAGTAATCGAAAGTCTGCGTCGTCTCGAGCGTGCT
GCACGTCAGGAACTGCTGCGGCGAGAGCGACACAGCCGCCGACGCGTTCTCCGCAATCACCACCGCAGTCTCGATGGCATCCGCAGCGGCGAAGGCCCAG
CAACTCCCGCAGTTCTGCTGGCTCTTGACCGAAGAGCACACGCTATAGCCGAACGAGTTGTCCGTGTCGCACCAGTTCCAGTACTCGGAGCTGCCGGAGC
TCGACACCGTGATGGTCCCCGTGGCTGTGCTGCCGCTGGCCTCCGTCATGAGGCGACGGGAGCGCGCCGACTTGACTTCCTGGTCCACGAGCTGCTGCGG
CGAGAGTCTGCGCCGCGTGGACGACGTCAAGTGATGCTCGTTCACGCCCATGCGATAGGAGAAGTCGTGGCCCACGCTCTTGGAGTACATGAACACGTCT
TCGATGTATGTCATGTGCGCCTGCAGGTTGCGGTGCATGGGCTCGCGGTCGCCGAAGGACACGAGGTTGCGCTGGACGAGCAGCTCCCGCAGAGTCTCCG
AGGCGACGACCTCGCCGTTCTCGCCCGCCCAGAGGCACGGGGACGCGGCCGAGCGCACGGCAGGACAGTTCACGAGCGCGCCGAGAGAGCGCTCCGTCGT
CTGCACACCGGAGGCAGCAGCGCTGGCCGCGGAGAACGCGAAGAGAGACGCCTGGACGCGCATGTCGGAGGAGGGGTTCAAGGGATAATTCGGACTGCAC
CGCCTCCGCTGTCTCTCTTCCCGGCAGTTGGACACAAATACCCTGAAAAGTGATACCTAGCCCTCTGGATTAAAATAGTTAGACTTCAGAGGATGTTAGC
TATATAATCACCCATATTTGAGCTGAGTATGTACAGTACACTACCTTTAAACAATAATTTACCTCTAGTTTGTGGAATCAGCCGTACACACAAGAACAAA
GTGAGTCAGGGCATTGAGTTGAGGGCCCTTCATGCCGTGTCAGCATTTGCTTTGATGCTGATACAGTCCACGGGCAATCTCGAAACTATGATATGAGTCA
CACGGGCGAGCAACCCTGCTGCACTGCAGCCTGCAGAGACATCCACCCCCAACCAAAAATCCAGGACCTGCAAGCGCGTTTGACTTGTTTTGCGGCGTCG
CCGGCCGACAGCGAACGCAGTACCAAGGGATTCTCCTGCAACTCGCAATCTCTCTTCGCCAAAGACTCGTAAGAAGAAACATGGACGCACATGGCGGCGT
GAATCGGTACCGGTGGCAGGGATAACATACGACGCAAAAGCACGCACAGTACTGAGTCGACAAAAGTTGGATCGGTTTGTCTTGAGCGACTTCTTGCAGC
ACATAGTAACACCAGGTAGGTACTGTATCGCCATCTTCGCTCGAAGTGGTTTCAAGCATTTGGTGGTGGTCCAGCTGGCGCTCCGTTGCCATCTTTGCAG
TCGCGCAGCGGGGGATGGGGCAGTCAACCAAGCAGAGACTGAAGTTGTCATGCGCAGCGACCACAGACAGCAACGCTGGACGCGAGACTCACCTCGGCGC
CCATTCCCAGCGCGACTTCGCAAATGAGCTTCGCGCATTGAGACGCTCTCGTCCTGGGTGAGGGTCTATGATGAGTCCGCGCGGCGGGGCAAGGTGTCGG
CCATGCATAGAGGCGATGGATCTCGCTTCGCGAAGCGAGTGATTGAATTTTCGCAGCAGATGCGGCTAAAAGCCTGCAGGTTGCCTTGCACTCGTGCCCT
GCTGGTCAACAAAGCCAAGCCCATTTCGCTGCTTCGGCCCTGCTGTTCTCTGCACTTTCGACGGTGCAGCGGTTAAACCGGGCGTCGTCACCTCATGGCA
CTCATGTACGCGGGCAAAGATGCCCGAATCGAATCCACCATGAACAGCAGATCCGATGCGCCCCTCCTCTCCAGCAGGCGGCTGACGGTCCCTGACCACC
GCATCCTCCTCGATGATCTCATTCTCGCTTTCGCAGCCCCTCAAGAGCTTTCAGCACCCTAGACGACACCTTTCTTGAAGACAATGGCGACCCAGACCGG
CGTGAAGGAAGAGGCCCCGCTGCAGATGAAGGCGGTGATCGAGCCGCAGTGGACGCGTTTCCTCGCGGGTGGCGCGGCGTCGGCAACCGCCGAGCTGCTA
ACGCTGCCCATCGACATCACGAAGGTGCGGCTGCAGACGCAGCGCTCCGGCCCGACGGCGGGTGGCAAGCCGGCTGTGCACTACAATGGCATGCTCCACG
CGGCGCAGACAATGATCAAGCAGGAGGGGCCCGCGTCGCTCTGGAACGGAGCCACGCCCGCGCTGTTGCGTCAGGTGTCGTACACGAGCATCTGCATGGT
GCTTTACGAGCCTCTGCGAAACTTCTTCGGAGCCAACGCAGCGCAAGGAGCGAACGGGGAAGTCCCATTCATCAACAAGTTCCTGGCTGGAGGCTGCGCC
GGCGCCATTGGTATCAGCATTGCCAACCCGTACGTATCAATGCGGATGACGGCTCCGATGCGTGCTCGCTAACTGTACGGTGCTCGTGGTTGTTTGTATC
TGCAGTGTTGATGTGATCAAGGTGCGCATGCAGGCTGACCGCTCGGGCAAGCTTTACCGTGGAGTGGGCGACGCCTTCACGATGATCTACCAGCGAGAAG
GACTGCGCGGGTTCCTCCGCGGCATGCCGCCGAACATTCAGCGCGGCTTCATCGTGAACGCTGCCGAGCTGGGCACGTACGACCACAGCAAGGAGCTCCT
GATCTCGTCTGGGCTGCTCAAGGAGGGCGTGCTGGCGCATACCGGTGCCAGCTGTGTGGCGGGCTTCGCTGGTGCGGCCGCATCCAACCCGTACGTGCTC
TGCTTGCTTCAACTTGGTGCGGTTTGAAGCCGTCGACGTTGACCTTGTGTTTGCTGTGATGGTTTTCGTTATAGCATCGACGTGGTCAAGACCCGGTTGA
TGAGCCAGCCGACGGACGCGAGCGGCAAGGGTCTGCACTACAAGGGCATGGCGGACTGTGTGCGGAAGACTTTCCAAGAAGGTGGTCTTGGCGCCTTCTA
CAAGGGCTTTATTCCCAACTGGATGCGCAAGGCGCCGTGGTGCGTCGTGTTCTTCGTCACGTACGAGAAGTACCGTGCGGCGCTCACGCCCAGCGACGAG
GAGCTATAGACGCTGGTAGCTAGACTTCCAGCAAGCGCTGCTGGGTCGGTATTCTTAATGGCAAACGAACACGAATGCAGCTTGCGTCGATGCTTTTTGT
AATCATGCTGCTGTATATTAACTGTTTGGTTAGTTGCTTGAGGATTCACGCAGAGAGCACCGGCACCATTGACCCACGTCGGCTTATTAATTTAAAGGTT
ACATGAAGTCACCAAGCGTGTCTGTTGTGGGGAGGGCATGGGCTGGAATGGCGTCCTGGAAGCTTCTCCTTCGCTCCCTTATCGCTGGTGCTGCATGGGT
ACGACGTCGCTATTATCTTTTCTTGACCACCGCTCGCTACAATGTGTAGGTGGCTCGCGTACATGCCCCCAGCTCAGCCCCCTTGCTTTCTTCTTTTCTT
CCCAATGTGCAGTTCCGTTCATGAATTGGAAGTCCGTTCAGCAGTTGAGCTCCTCGAAGTCGTGCATTTGCATGTACCATGTCGAGCGTGGGGGAGTGAG
GTAGTGCAAGGTCGAAGATCCCGCAGGCATGTTCTTGACCAGCTTCTCCCGCAGATCAATATACTCGTCCGTCTGCACTACCTTGATCTTCTCGTTGTCC
GTGGGGATGGACACCTTGCCGCTCTTGGGTAGCATCACAATGGGCAGCCGTTCGATCACGCGGTCCTCCGTTGACCAGCGGTCGCGCGAGATCACGTGCA
CGTTCAAATTGGAGAAGGAGCCGTTCATGAACCGGTTGGAGATGGTGCTCTCCACCGACTGCACGGGGGCCTCCTCCTCCTCCTCCTCTTCAGAGCAGTA
GTAGGCCGGGCACGTGCGTCGACGGCGCGCGTGGTTGTTGCTGTTCTTGGCGAAAAGCGAGCGGCGGAAGCGGTCGCGCTCCTGTCGCCGGCTCTCCAGC
ATCTCCTCGCGGGACATGCGCTGTTGGTTGGAGCTTTCGTTAATGGGCGCCACCTGATTGCTGCTGCTGTTGCCGCCACCGAGGAAGCTGCCGTTGCTGC
CGACGCTGCCGCGGTTGGTGCGGTTCAGCGCCTTCAACAGCTTCTGCAGCGCCAGGAACGTCTCATCCACCTCCTCGTCCTCGGCGGAGAGGCTAGGGTC
GTCGTCCTCGGACGGGCGACCGCCGTACGACGGCATCTTCTTGGACAGTCGGGCGTCTCGCCTCTCGACCGTCGCCATGGCTGTCTGCTGTCTGCTGTAG
TGCGGAGTCTGTGGTTGTTGCTGCAGCGAAGAGCGAGACCTCCGGGTCATGCAGCAAAATGTGGTGTGGGTCGCTGTGAGGTGGGAGCTTGTATCTGCGC
GCTCCACCGTTCGGTGCTGGCGTGTCTACGGCCGCGAGGGAGGGGGTTCGCTTTGAGAGAGAGCGCTTCTGGCAGCCGCGCCTTCGAGTCGCTACCTGCC
TTCTGCTAGTGGACAGCAAAAAGTGATTCTGGGACGCCATCGGGCCCGCCGCCTGCGCTCGTCTTCCACGGTTCATAGACACGTCGGGTACAATCGGATT
TTAAGGGGTCTTCAAAACTGAGGCTCTTTTTCGCAAAAGTCGGTGGAATCTTGTCGGAAGATCTGGAAGTTTGTCGCCCTTTGTACCGTGATATGCTGGT
ACATTGTCGTCCCACCCTGTTTTGATAATCTGTGGATTCGATAATTTCGTTTTCGGCGGAGAAGGCGCTCGCCGGCTGCAATCTATCTTGCGAGAAGCTG
GGACTGCGGGCCAGCAGGCTATTCCTGCATGCGGTCTTCGCGGTTGGTGGCGCGCGCTAGCCGGCAACGAACACGTGCGGCATCATCCGGCGAGAAAGTG
AAGGTAGGTAGATTGCCGGTGGGAGTAGGGTTGAAACTCGGGATGGCCAGCGTGGCACTGGCTGGCTCTGGCGTAAACTGCTCCGCCTCGGATCTCAGGC
GGATTTGCTTGTAAAGCGGGGCGCGTTGGTAACGAGCCGCCGTCCAGGCAGACCAACATGTTCGCCTAGGATGATACATGTATGCCTGGTTGCCTGCCGC
CGAGTTGCAGGGCCGCAGACGCTCGATCTCCCGACGGCGCAGCAGATCAGTCCGGAGACCACTTCCGAATGAGCCCCCGCGATGGCTTCGCAGCCGCCGT
TGGACCCAGCTCGCTCGCTCGCGGCGTCATCGCCGAAACCTGTCGCAATGGGGAGTCCGACAGCAAGGCGCGCGCAATGCTGCTTGCTTCGCCCGCGGGG
ATTCAGGCGCGCAGCCTGCCGACAACGAGAGTCTCACACCTTCGCCTGCGAGTCGCAGGCTGCGACGGGACCCGTGCGGGCCGGTGATCTTGAAGCTTTG
CTTGCGAGTTGTTTCCCGGCTAAGTGCGACGGCCGTTTTCTGTCCGTGCGTCCATCCAACAGCCGCTTCAACTTCTGCGTAATCCAGCTGTGTGCACCAC
ACCATATCGCTCACTTCAACTCGGCGACCTTTGGGCGGGATACCGGAGCGCTGCATCGCAGCTGCTGGCTCTGCTGCTGTTGCTACCGCCGCCGGGATGG
CGGACCTGCTGATGCGCTGGCTCAACCATGAGCTGGAGCTGTCCACGCACGTGACGGACGTGGAGACGGACTTCGCTAGCGGCTACCTGCTGGGCGAGAT
CCTGCACCGGCTCAACCACCAGCGCAACTTCGCCGACTTCATGCGCAGCTCCAGCGCCGACGCCAAGATCCTCAACTTCTGTCTGCTCGAGCCCACGCTA
CGCAACCTCAACATCAAGTTCGACGCTAACGCGGCCGCCGCCATCATGAACGAGAAGAAGGACGCCGCCGCCAATCTGCTCTACCAGATCAAGGTGAAGC
TTCGTATTAGGCTCTCGCTGGCGATGTTCTCCTTGCCTAAACTGCTCGCTGTGCCGCGTAGATTGCCGCTGCCCGCGTGGGAAGAGCGCCAGCCGTGTCC
TCGAAGTCACTGGAGCGCACAGGCATCATCCCGTTGCACAACAGACCGGTGAAGCTAGCGAAACCGAGCTACGACACCGAGAACCACCGGTTGTTTGAGC
ACTCGGTTCGGCGGCATGTGCGGTCCATAGCATCTCTACAGCAGGAAAAGTGCGGTTGACAATTTCTACTCGGCACGCTGTGCTTGACTAATGCTGATGA
CGAAATTTTGATGTTTGTCACCGCAGGGACCGGATCGCAGAGGAGGCCACGAAACGAAAAGCCTACTTGGCGAGAATGGCCGAGCAGAAAGAGATTCTGG
AGGCCACAAAGGCGGAAAGATTGCATCGTGCGTACATCCATAGCAGCTTTATTAAGGAAGCTCTCGAAGAGACGGACTCACCGGCCTGGAGGCTGGCGCT
GCAGAAGAAGAATGCGCGGGAGCAACGCCGAGCTGCATTCTTTCAGCAGCTAATGAAGAAGCGCGAGGAAGCAGAGGTTATTTGGCGATAAAATGCGATG
CTTGTATTGTCGTTTTACTAATATCCTTGGGTTGATTTGGTAACCAGGAAAATCTCACCTTTAGCCTTCGACGAAAGGTGCAAAATGATCTGGACGACTT
TTACGTGCGTAGTGAAGATGTGCACATTACCTTTTTTGAGTTGGTGGTGCTGTCCATTGACGAAAATTTGCTTCCTTATACAGAGCAATGGCGATTCGAA
GATCACGACCTCTGATGGCAAGTTATCTTCGCGCAAGTCTGTTGGCTACGGTCTACGCTCGCTCACAACTGCGCTGGGAGCATCCTTCGACAAGAAGAAG
TACTCAACCTCCAATTTGGCAGGATCGTCTATGAATGAGAGGGAGCTCTACCACGCCAATGTAATGGAAATGGAAAGCGCGCGAGATGTCATAAAGCAGC
AGAGGTTGCAACGAGAGAAGCGCAAGGAGAATTTATCTCGCAGACGGAAGAGATTTGTTCAAGAGTGCGTCTATACCCACTCTCGCATAGGAACTGCGCG
GGTGGCAAGTATTCTTGAGGATGTGGTGCTGCGCGACACGAACAGCGAAAAGGATGTTAATGGTGAAATGAACCGCATTCTCGTCTACAAGGAGGTGACT
CGCGAAAACAGGTCCATGCGAAATCAAGAGTATCTGAACCAGCAGGAAATGGACACCATGTCAGCGATTGACCGAGATACGAGTTGCTATCACAATCTGC
TTCTTAGATTCGAAGACGACAACGAAATGCAGATGATGCAGCGCAACGACGTGCACGTATCCATTGAAGCAGCAGATCGGTTTCTCAGTGAGCAGATTTC
AGCTGAAATCATGAACGATATGGTGAAGTTTGTGCTATTTATCGCTGGAAAACGCGAAGAAACACTTCATTCCAGAGACCCTGCCGTATTTTTGACTGAG
GAAACTTGGAACGAGTACAAAGTGAAGTTTGCAAGTGGCCATATATTCGAAAACGAGTCGCCAACACAAACCCAAGAAAGTTCTAGTCACGTTGAGCTGC
TGGATAGTCACGAGCTGGAAAATTATTTATCAAGCTTTCGGACTTTCCGTACAACATTCGACCAACAGGCCCCCTTGCAAACGATGGACGATGGATCGCT
ATTTCTTGGAGCAACGGGTCCCATTGAGGACTGTTTCGTTCTTGGAGAAGAGATTAAATCTCTACGATGGATCGCTCAAGATGTTGCTAAAGATCCGACC
TGGTCTGAATCCCCAACTTTCGCAACAAAAGCCCACCACCAGCTCCGAATTCTCATCTTCGGCCCTCCATTTTCTGGTAAGGGTACGCAAGCGAAGCTCC
TAGGTGAAACACATAATCTGGTTGTACTCTCAGTCCACGATCTAATTCAAAAGAGCGTTGAAAGCTCAAGTGATACTAGCCAAGAAGTGAGGGAGCTCCT
ATCAAGCGGGAAAGAGATTCCCCCAGAGCTATACAGCAGTCTAGTAGTTGAAACCATTGGTGAGCTGGAGGCGCATGCCCTTGCTTCAGAAGGAGGTGGC
GGCAAGTCTGGATGGTTGATTTACGATCTGCCTGCAACAAAACAGCATAGCCAGCAATTGGAAGAGCGACTGTCTGGATACGTAGACCCAGCACTTGTTC
CCTCTCCGTCTGACTTTGGGTCTGCCATTGCCCCAGGCCTCCGCAAACCGAAATTGTCACCGACATTTCTACACGGTAAATCCGGTGTAGACCTGGTTTT
TCATATCAATTGTGCTGTTGGTACAGTCCTCGACCGATGCTTAGGCAATGTTAAAGATTGCGCTACCGGTGACAAACATCACTTAGTGTTCGATCCGCCA
CCAGATAATTCGATTGTCCGGCATCGCTTACAGCATGAAAACCCAAGCGCGTTCTCGAGTGAGCTCCTTTCGTTGCATTGTCTGGCCAATGAAGAGTTCT
CAAACGACCACAAGTCTTGGTACACCAAGTTCAACACATTGCACGAGCCGGCTAGCCCCGGGATGACTGTAAACGAAATCCACGAAGCGATTGCGGCTAT
CGTAAACCAGTTTCTGAAAGACCGACAAGGCGAGGCCGAGTCAAAGCTACTACAGCGAGAGGCGAAGGAGCAAGAACTAATGGAAAGCGAAGAGGAGAGA
CAAAGACGCATCTACGCGTTCGAATCGAATATCGACGAGGCTAAAGTGGAGGTTGCCAAAATGGAGGCAGCCGTCGCTGAAGCGGAGGAAGCAAAAGCGA
AGAAAGAAGAAATTCTGGAGCTTCGTCAGAAACTAGAAGAGGCTCAGCGTCAGCTAGATGGTGTTGTGGCTGGTGTGAGAAACTGGGTGGACGAAGAGCA
GGCGCGTCGGCCTGTGCCAAGCAGCCAATATTCTGGAGAGCTCGTCCCAGCGACAGCTCATGCATTGGCAGCGTTGTGGAATGATGCGGAGGCAGAGTAC
ATTTCTACCATGAAGACCAGTTTTGTACTGCTGCGAGAACAACGGCATCGCGTCACCGAGCGCGCACAGCTAATGACGAGCGAGTTCTGTGAATTTGTCC
GTCGTCCTGATCAGAAGCAGGAAACGGTGAACCTCTTTCAAAAGCAGTTTAACGAGGTGGTCGACGAAATGCGGTTCGATGACCTCACGAAGGCTGAGCT
CCATGCTCGAGTGGATATGTTGCAGGATGAGCTAGGGGCTCTCATTGACGCAAAAACTGCAGCAAATGACGAGGAACTTAGCAGTATGGTTGGTGACGGC
TGGACTGAAGATGCTTGTCAACAGGTCGCTGCCATATATCAAATGGCGCTACAGGCGGAATGCGATCGTTTTCGTATCTCCGTCCAAATCCTTGTAGATG
GCTACTCCGCGGCTAGCAGCGAGCGCTCTCAGCTGGGTAGCATTGTGGAAGCTTGGCAACAACATCAGCCTCGCTTGGAGATGGCATGCCGAATTTATCG
AGATCAGGCAAATGATACGCCGGTGGAAACCCCTGTTGCACCGGCAGCTGCTGCAGCAACGGCGGCAGGAAAAGCTGCACCGAAAGGTAAAGCGAAGGCA
CCTACACCGGCAACTGCCGCTCCGCCTAGTGCCGCCGCAATTAGTGACGACGCCCAAGCAGAAGCGCTGACCCTGATTGAGCTGCTAGCTGAGTACACCC
ACGTTCTTCAGCGATGTGCGTCATGGATGGAAGCAATTACTCCAATTGTAAACGCCGCAACTGCTGAAGGAGGCGACATTGAAGGCAGAGAGCACACTGG
TGACTACTGCAAGATCAATTTGCTGAACGGGATCAGATATGAGCACGACTTAATGCAACGGCACGTACAGTTCCTTCAAGAGGCTACGGAAAAGTCTTGT
GATGAAATTACGCGGTCGATGCGCTCCATCGAGATCACGTTGCGAGATGTTCTTGAAAACCGCAAAGACCGAGAGCAGGCGGCCGTCGCTGATTTGATCG
CGTACATCCGCGCCGCTATTGAAGCTGAAGTGGCGATTCCGTCGTTCATCGATGCCAGCGCAAGTGCTTCTTCGCTCTCTTGCCATTGAAAGGTTAGCAT
AGTCTGATCTGTGTGTGTTGTTGTTTGTGTGTTGTAGCCTGAATTCATCGAGCGGTTCCCAGGGTTAACTGTACAGTTGCCTGAGGACACGACCGTACGC
GTCGATGGAGACAGACGCCTGTTGCCTCGAATTCCTCCAGACGCGCCGGCTATTGCTGAAGAAACACACGAATTGCTTCTCAATCCTCGCCAACGAGACG
GTCTCAAAGAGGCATTAGCATCGCAGACTTGCGGCGACTCGGGGCTACTTCCTTTGTGCACTTTGGTCGAGGTTATTGCAGCTTTGACCTCTCAACCGGA
CGCGCTTCCAGAAGTTTGGCGTCGATGTCCAGCACATGTCATCGCTGAGGTACAGCCACTACTCGCTCACATTTGCCTTCGTCGAATATGATACTAACTT
GCATCCCTTGTCATTGCGTTAGCAGATCGCGGCAGGCTTCACCATGAAGCAGTCGGCGTTCGTCGACATTGAAGCTCTGCTCACTGCAATGAGCACCCGC
GAGGATCTACTGCACCAGTTCCAGGAAGATGAGGCTCGAGAAGAGCTCGAACGGCAGCAACAACTCGAGCTTCAGCGTCAACAAGAAGAGCAGGAACGCG
AGCTTCTCCTCCAGCAGCAGCAGGACATCCAAGACAGCGAGCCTGCACCCACCGACGTAGCAGAATAGGCATCACACCACACAAGGGAGACAACAAACAA
AACGAAGAGGCCGTTGCACGTAAGCAACAGCCGTGTATTACCCTCCAGTCACTCAATCGCGCCCGTCTTGCCTGGCCTCGTCCGCTCTGCTGTCCACCTA
CTCTCCCTCTCACTCTCACTCTCACTCTCCTCACTCGATCTATATCGCCTCTGGCCTACAGGATGACGGGGTTCTCGCCCACTTCCGCGACGAAGTCGTG
CTCCTCGCCCATGAAGATCTTGAGCTTCTTGTCCTGCAGCGCGCGCATGCGGTTGCGGGGCAGCATGCCGAACACAGCCTTGCGCAGCACCTCCTCGGGC
TTGCGCTCGAACAGCTCCTTGGCCGTGCGCTGCTTGAGGCCGCCCGGGTGACCCGTGTGCCAGCGATATAACTTATTGTTCCACTTGTTGCCCGTGAGCA
CGATGTCCTTGGCGTTGATGACCACCACGTAGTCGCCGCAGTCGACGTTCGGGGCGTACGTGGGTTTGTGCTTGCCGCGCAGAATGGGCGCGAGCTGCGA
CGCCAGTCGCCCGAGCACCTGGCCCTTGGCGTCCACCACGTGCCACGCCACCTTGGAGGCCTGCGCGATCTTGCTCATGCTTGTCTAGCGCTGGTGTCCT
CTTCCGACGTCGAGCTCTGCTTGCTCCTGGCCCCAGATCAACGATTGAGGCCACCCGTCGCCGCGTTCTATTGGAGGCGTAATTTAAGCATTAGGGTTGT
GTAAACATACGTTCTTTTATATCAATCATACGTTTTGTATAACATGAAAAAGGGTTGCTTTATTACAAGTGAAAGGCATTGTGATCCATGTATTTTGTCC
TTTTTCCATGCTAAATCACCGAGATTAGGAGATTTATACTGTACTCATAGTAAAATCGCTCATTTAAGAGAAATATGGGTCGCTACACGACCGTGCAGAC
CTTCAGCGACCAGGACGCCAAGGGCGCCGCCGTGGCCTACAACGCGGCGTCGGAGCCCGCCGCAGCCCCCGCCGATGGCGCCAATGAGTCGAAGGATTCG
TCCAAGCTCCACATCAACCGCGTGGACAACGTGTCCGGCAGCTCCGCAGGCGCCGGCAGCGGCGACTTCCACACGTACCGCGCCGCCAGACGACGGTACT
GTGCTTGACTTGACCAGCGCCCACATAGCGTCAATGTGTCGTGCATTGCGTACTGTGTTCTCATGAGTCTGATCTTCTGGCAGAGAGATGGAGCGCGTGG
AGGCCATGGAGCAGCGCTACAAGGAGAACAAGGCGCAGCAGGAGTTCGAGGCCAAGCGCAAACGCAGCGCCGAGGAGTTCGACGCCAAGATGCAGAAGCG
CGCGGAAAAGCGGCGACGACGCAAGGAGCGAGCGAAGGCGAAGGCTCTGGACGGAGTCCAAGAGGAGCATGAGGAGGAGCAGAAGGAGGAGAAGAAGGAG
GAGGAGGAAGATACTACCGGTAGTGCAGACAAGGAGAAGCAGGTGCCCGAGACGCCCGGCGGCGTGCCGGAGATCCCCAATGACGGCAGCTTTTTGGAGA
AGATGCTGACCTTGCAGAAGCAGAAGGCGGAGAGTGAGGAGAAGTGATTAACACGGGGCCGTCCACAGGTTTGGTAGAAGTATCCATTCATTCAGTTGAT
GCGCATGCAGGTTCTCGTTCTCTCTTTCCTTGTTGCTAACAGGTGTTGGCACGTACATACACAAGAATCATCGGCAGCTAACTTCCTGCAACTAGTTGTC
GTCCTGGAAGATGAGCGCGACGCCACGCAACACCCACTTGGCGCTGCCGCAGTCGGTGGGGAGAGTCGCCAAGAAAATGTACGTGTGGCCTCGGAAGCGA
GTGAGGTACACCGGGCACTCGTAGATGTTCGGATCGTGACGCAGGTAGCCTACGGAAGACGGCTCCCAGGTCGGGGACGTGGTCACAGCCTTGACGTAGA
CGACGGGCATGCCCCAGAGGAGCTCCTTGGGATTACTATCCAGCAGTGTGCCGCCACACTCCGTCGGAGGCGAAGAACCGACTGGATAGCGCTCGTTGAT
CTCGTCTAGAGTACTCCAGCGGGCACCCTCGAGGATAAGCCCGTGCACAAACACACCGTCGTCTGGGTAATACGAGACGGTCGAAGGGTCTTGAATCGTG
GTCACGTGAGTCTCCACCGTCATCTGGTTAAGCGGCATAAACCGCTTACGAGACGTGACTTGCAGACACGCTGTCGTGTAGGCTGTGGGGTTAAAGAGGC
CAGGCAACCAGATCGAAAACGGCGTGACGAAGCAGCTACCGCCTCCCCCAGTGGTGTCACCTGCCCACGCAGTAAGCTGTTCGTGGCGCTTCACCATGTC
GGCAAACCAGCCGCTTAGAGACTTCGTTGACGGCCAAGCCTTCTTCTCCCACTTACACTGCGAGAACGGGTTGCGTCCGGGCACTTCGTTCAGTGACATG
GCTGTGGCCAGGTCCTCCATGGCTTGGGACATATTGAGCTGTCCGTTGAGACCCTTCTTCAGATCGCCCAGCGATAAGCGGATCTCCTGCAACAGCACAT
TCATGCGGCTGCACTCCTGCAGTGCCACCACTACGAATGGACCATGCTCCTCTGTCAGGTGGGGCGTTGCAGCTTCCACGACATCGAGCATGTTGAAGAA
CTCGGGGCATCGCGCCTCCAAGTCGTCGATGGATGCACGCAGCGCGGCCGTCTTATCACCGCCACCCCCTTCCTCTCCGCCGCCGCCTCCGGCTCCACCA
CCAATCGTCACAATCGTGTAGCACAGAGTCTCGCACGTTGTGGTAAGGTAACCGATTTCAGCGTTCGGGTGAAGACCGAAAAGCGGTGGCGCCTCGGGAA
CCATGTTCTTCTCGATGTAGTTGGCGTAGTCTGCAAACGAGAATTCCTGCGGATTCGGCGACTTGAAGCCAGGCCCAAGTTCCATGCCGCTAAGTAGACC
AGGGTCGATGAGGACTGCCAGGTAAGTGTTGTTGGTACGACGATCCCAAGCATCCGTGATGTGACCACCGTACATGATCTCACCAAAGAGATAGCGGAGA
TCATCCCACGGAACGGATGCGTTGTTATCCAGGTACGAGTGCAAGATGTTGGCACAAATGGTAAGGTCGCCAGTGTTGAAACTGTAGGCACGACTCCAGC
CTTGCTGACCAAAGCGTCGACGTCCAAGCACGATTGCGTGGAACCAACACAGGGAGAACAGGCAGGCCTTGAACTCGGCCGGCTTAGTGCAAGCCTGAAC
CTTGTCCTCGCCAAAGTTGGCCCAAGCACGACGCAGATTCGACTGGATGTCCGAAGGAGCCTCGTTGGCCACCTTGATACAGCTCTGAAGCAGAGACTCA
GGAATGTTCAGCATGTCTGGTAGCGGAGGCGGCTCAGCGGAGATAAAGCAGCGGAAGAGATCATGAGCACCTTCGGTTGCTACCTCTTCTAACTGACGCT
CGAGCGTCGGCAACCACGACTGCATCAAATGCACATTCTGCAGGATGATCCAGCCGCCTTCGGTGCTCAATCGCTTCAACGCGTCACCTGCGTACGCCTC
TTGACCTTGGCCCATCGAAATATTGATGAAATTGTTGTTCTCAAGACTCACTCCGTTTGCCTTTCCAAGAGTTTCTACCCATGGCGTTGGGTCAACTCCA
GGGAACAGCACGAAGAATATCGGGATGCTCGAGTTCGTCTCGGCGTATGTGGCCTCCATATTGAACGGAGGTTGAGTGACGTATTCCTCACCCAGCGAGT
CAAGAATGAACGTGCGCAGAGCATTGGTCACACGATCGGGGCGCATCGCACGCAGCAGAATTAGTCGCTGGAATGGGGTCAGCTTGATGAAATCACCGGG
TATCTTCTGTCGTTCAGCATCCTCGGTAGCGAACCACTTTCTCCATTCATCAGGGTCATTTTGGATCGCATCACCCAGTCCTTGGAAAGCTTTAGCACTT
TCAAGCGCCTTCAACTTCGACCAAATTGCTGCGGGGAGCCACTCGGAGGCTGAGCCAGCGTTGCCTGCATCCGGGTGGGCCTTGCTGATGAAGAAGTACT
CAACTTCCGAGTCGTTCAACAATCCATCCTTGAGCAAAATCTTCAAGCACAGCATCGTTGCCACTGTAAGCTTGTTGCGCTCGAACAGTCCACGACGAAC
ATAGTTATAAACACACGAGGTGATGCTGTCCATTAGCACCTGGCATCGATCCTTCATCTCTTCATCAGTCAGATCCGGGACAGCAGGCTCACTCTCCACG
GCGTCTTCATCACCTCCTTCGCCACCTTCACCCCCTTCTGTTGGTGCTGGAGCTCCACCTTCAGCAGGCGCTGCTTCACCTTCTCCACCGTCTGCTTCAT
TGGCGATGAGGTTCTTCGCTGGCGGTGCCCGGTAGATACCAGACAAAAAGACTTGCTGGAAGGATGCGAGCGAGTAGATGTAGTAGGAGTGTACCTTGCT
GATGTCGTTCATCAAGAAGAAGAGCAGGGAACCTCTCGCAGCAATGCTGCGATACTTTTCACTCGTAATGTTCACAGACTCTTGCGTCTTCTTGGCAGCC
TCCATGTTGTTCTGTGTACGCTGCGCCTTGTGCTTGGTATCGCTCAGAATTTGAATCAGAGGCTGGTTGTTCGTGATATCGTCGTCTGCGCTAGCCAAGT
AGAACAGAATATCATCTTCCAGTTTCTTCAGTTCGATCTTTCCGTTGTTTTGTTCTTGGATCAATTTCTCGCGCTTAATAGCCAGATCTTGGCGCTCTTT
CGACACGACCAGGTTCAACAACTGGTCTTCCAGACCAAGCATCGTCACCGTAAAGTTCACGATGGTACATTCTGCTTGAATCTCGGGCGGGTAGTGAGGG
TTGCCTAGCTTCGTGTGCAGATACAAGTGGAAGTTGTCGTTGTACGGGACGGACGCGTCACCAATCTGAATTTCATATCGTGCGCCACGACGCGAAGTCG
AGCGTTGAATAACTGGAGCCAGGATGGGATCAATCTTCTCGCCCAAGTTTTCAATGAGGAAGGCTCCATCGGTACCGATCGCCGTTTTCAGTCGTTCAAT
CCACATCTTCTGCCCTACTCGTACGATGATCAGGTTGTTGTGCGCCTCCATCTCACGGATCCATGCAATAGCTTGCAGCTGTGGGTCGACAATAAGCGGC
CTTCGTCCCATTGACACCGTAGTCACCACAATGGCACCATTCTCTGTTGACACACGATCAGACGGGAGTTTCTGAGTGTTCCACTCGGCAATTTGGGCAT
CATTTGTCAGAATGAGAAGCGGGTTGGCTTCTTCAGACATAGCGATGCTCTCCCCACCGGCTGCAGTGCGCAGGTATGGCACCCAGTGCTTGTTAATGAG
TTCATCACGGAACGGCTTCGTGAAGGGGCCGATATACGAAATGAAAGCAGAGGCGAGCAACACGTCGCCCACCAGTAGATCCTTCTCCTTCTGAAGCTGC
AGGACGTTGATACCCCAACGCACATTTTCGCTGGACAGGTCATTAGTGAGTGTACCTGCAAGCTTCATCTTGCGGTTGCCAGTTTCGACTGCGTTGATGG
CGTCTTCCTTCTCCTTTTCCGCTGCTGCGGCTTCAGCCAGAAGCTTGTCGAGCTTAGCCTGTAGATCGGCCACAAGAGCCGTCACTTCGCTGAGGCGTGA
GTTTGCAGCTTCGAGCTCCAAGTTTGCTGCAGCCAAAGCCTGTCGCTTGGGTTCGACTGTAACAACGATGTCGTAGTACATGACGATGTTGATGACCCAA
GAGCACAAACCTGCAGCGGCCTTGTTCTTCGTAAGGATGGTGTCGTAGTTGAAGTGCTCCATCTCCAAGTACACACGGACCTCTTTCCAGTTCATAGGAG
GCACCTTTCCGTCGTCCACCACTTGCTTGAAGCCCACCAAGTAGTCGATGTACTCTGGAATGTTACCCAGAAGCTGCTTCTTGACAGTGTCCCATTTCAC
ATCCTTCACCTTACCAGTCTTGGTGACCTGCACGTTTGGATGCACGCCTGCCAGTAATACCATCGTGGCTGAGAAGACATCGTCCACACCAGCAGGAGGC
TTGGACATGGTCTTACACTCGCCCAGATCCTTCTTGTTCAACGAATCAAGCGCTGCCATAGCCTGCTCGACAGCAGGCTCGGCCTTTGCCAGATCCTCTT
GTGTAGAGCGCTGCTTCTCAGTGACCTCTGCCTGAATGATAGCGCACTTGGCAGCCTCGTCACCTGCCTTCTTGCTTTCAGTTTCAACGTTCGCCTTCTC
CTTGTTGACCGCCTCGGCAATACCGGACGCGACAGCCTTCTTGTCCTCAGCAGCTTCGAGGATGACCTTCAGTTCGACCTCAAGCCGTGACACAGTATCA
CCAGTCTCCTTGAGTTTCTGCAGGCCTTTCTCTAAGCGATCAATAGCTGCTGCATACTCCTCCACTTTCTTGCGCAGAATCTTCTTGTACAGCTGAAGCA
ACTCCAGATAGGACTTCGGCGTCGTGTACACGTGACGTCGCTCAACCTGGAAGAACCGCTCGGCACAAATGTTCACCGACTGGAACGAGAACGGCATAAA
CTTTTCGATACCAGCGCGAGATTCCTCCGACCCCAACAAGTCTCCGATCTCCTTCAGCTTTTCCCGACCGACAGAGAGCAGAGCTTCCTTAGGCCAAGGC
TGGAACCAGTCAATAACTGTGCAGTTTACAAGTGCAGGGAACTTGCGAGCGCGGTTACGGAAATCGTCACCCACAGGCGAAAAGCAGAGACACAAGTGCA
GGCGTTTCCGAATCTCCGCTTGGAAGAACTTGATCACCTCCTTCCGATCTTTGGTACCAGCAACAGGCGACAGCAAGTTGACGATGTTGTCCATATCTTC
CATTGCGAATAGATCTGGAATCTCTCCTGACGCTAACAGATCGTTCAGATAGATCAGGAACTTCTCGTTGGTGATTTGGGAGTCCGTGAGCATGAACACA
ACTCCTCCATCCTCTTCGTTGCGAGACAGCATCTCCACCACAGCCATGTGCATTTTGCGCAAGTCTTCCTTGAATTCATTCTCGCCGTACTTGGAACTGA
TCGTGATTTGGCGAACAGTGTAGCCGCAAATGTGAGAGGCCAGGCGTGCCAACGAACGCTTGCCACTACCTCCCACACCAACTAACAGTGCGTGGCCACT
CTCGTTACGCAGAATACGAACGATGCGAGCCACGTGCTTGACTGCATCGTCGAAGAGATCCAGCTGCATAGCGGTATTGTTCTCGTTGTTGTTGTAGTCA
CGCAGCTGAACCTGCAAGTTCATCTTGAGATCGTCCAGGTTGGTCCCCATGATCTGGTCGTATTCACTATCGCCATCTTTTGTGAAGTGGCAGAAGATGA
GCGGCCACGAGTTCTCTGCAGCGTAATAGCGACTCGTATTGCAGGATGCAAACGACTTCTTCACTTGCATCTGCACCAACTGGTTGTACTTCTCAATGTC
CGCCTTGCACACAAGTCGATCTCCATACACTCGTTCGCTCTCGTGTAGCCACAGCAGCACGAACTTCTCTGTGCTGTTAAATCGATCCTTCTTGGACGCG
ATCAAACCTTGGAAGACGTTGGACAGGTGACGCACGTTGAACTCGTAGTGGAAGTTGGCTGCCGTCTTACGGAACGTGCTCACTACACTGGCGTGGAGAC
TCAGCGCTGCCTTGATCAGCGCGTTGGAGAACTGCGAGTTGCATAGCTCATCGGCAAATCCTGACAAATGTCCACCAAGGAAAGTCTCGTAGATTGTGAC
CAAACTTGGTGCTTCGGGCATGCCCATAGCGAATGTACAGAAGTGGCGCTGAAGGCGTGGGTCGACGAGGAACGAGCCTGCCGTGGGATTCATACCAGAT
ACCACTTGAGTATTCAGGATATTCTGAGGCTGGAGCTTCACGCGGTCGAACCAATGTCGGTACTCCATCACCTGTCGTAGCAGCGAGATAGCGCTCTGTG
TGTTGTAAGGGTCCACTTCTGGCAGATTCAGATCGTCCATGAAGTAGATGAGTCGGGCTTTGCCTGGTGGACCAAGGTTGATACCCGTCTTGCGCTCCAG
TTGGCCAAACATGGTCTGCTGCAAGATCGCACTCGTGGTGTAGAAGTTGAAGTTGATGGTGCAGTAGCGGAATGCAGCCGTCGCCTCGTCCTTGCTGAGC
TTTTTCAGCATGCCCATGATATTCTGCGTCTTACCGGTACCTGCAGGTCCGCATACCATCACTGGAACACTCTTGGAGATGAGGTTCTCCAGCCAGAATG
CAATCGATGCCGTCTCAGTCGTAGGCACAGTGATCTGGTTGATCGGGCTCGGAGAGACATACGTCTCGGTGTAGAAGTACGGGCTCTTAGACCAAGAATT
GAACTTGGACGTCTCTGGATCTAGCCAGAAATCAAACACAGTGTTGCTCGCCGACGCCACCAGCTTCACATCCTTCCACTGGTTCTTCCACCAGTTGCTA
AACTCTGCCGAGTAGTCTGTGCCATCGTCACTCATTGTGAGGATGGAGCCGAAGGACCATACGCAGCAGAAAACGAATGTATTCTGCATCACCGTGTAGT
CTTCCAGCACTTGAGGGGTCAGCAAGCAGTCGATCATGTTGAGCAAGTTCGTCACAAGTGTCGTCTCCTCCACTGG