Description :
From Genome Similarity Track
Location :
Scaffold_21:58301- 59986
Transcript NameFunction/comments
Phyke_g1362hypothetical protein PHYSODRAFT_321830

Sequence
1685 bases(100 bases per row)
TTCGCTTAATCGTCTTCAGCAATATcttcttccatctcgtcctcgacttcgtcgtcatccgCCGGGCGGCTCAACTTCGCCTCACGCGAGTTTGGACGAC
TCATTGCTGCCTCACGATACGCTGGTCGATCAGCCTCGCGCGAACCTGGGCGGCTGAAATGAGCGTCACGTGAATCTGGACGACCGGACTTAGCCTCACG
AGAACTTGGGCGACTCGACTGGGCTTCACGGGAGCCTGGACGGACGGAGGGGGGGCTCTCTTTGGCTTCGCTGCGTGTAGGCCTGCCGCGTCGGTCATCC
CCCAAGGACACGCCTAATTTTGCTTGTACAGCCTCAACCACCCGCGGGTCCACGTACGCTTTGAGCGTGAGCCCTTTGCGCCtcatctcctccatggtCT
CGAGGCTCTTGTTCAGGTCACCTTCTTCGTAGTAGGCTTCCGTTAGCATGGCGTACGCATCGCCCACACGAATGGCCTCTTCGATACCAGGTTCCTCTAA
TAATTTGGCGACAATATCCATCATCTCTTTGGGGTTGTGCTTTACCTGTTTCCTTGCCACCACGAACTGCTCGATTAGCAGAATGCGTTTCTCGTAGCGC
TTCAGCAGAGCATCCTTGCCGTCGCCTCGAGACTTGGACACCACCTGCACTGCTTCTTGCAACGCGGAAATTGCCTTCTCATAGTCACGATActcctcaa
tctccactTGTGCACAGCCGGCGTAAAAGTTCCCAAGCTGCTCAAATGCGCGAGCTTTCGTGTAAAACCCTACGATATTCTTCAAGGTGTCTCCGTCCTT
ACGCCAATCGAGGTTCTGCAGGTAGTTGGctgccaagatgaagatttGAGCATTGCGCGATACGTTTGCGAAGAAAACCACCTTCTCAGTGTCGCCCGAC
TTAAGCAAACATTTCATGGCCTTGAGCTTGTCTCCAGCCTGCGTATACTTCTTTGTGGCCAGGTGGTAAGAAccttgctgtttgcagcatTTGGCGAGTT
TGAGAAGCAGCTCTGTACGTCTCTTCTTGTCCGCGGGCGTGGAGCTATCATCTCCCTTGGGTGGTGTCATTTTCTCGGCCATTTCTTCTGTTACTTTCAC
GTCATTTTTCATGCACACATCCAGTGCCTCAGCAACGCGATTTCCAATCAAACACAAGTGCACAGCCTTGGCATATTGCCCGTTTGTGATAAAAAAATCG
GCACATTTCTTCAAGATGGCAGGCGACGTGTTGCCAGAACCACTAAGCTCATCTGTGAGATGGTGCAGCTCCTCAAAGAGCTGCGCCTGAAAGCACAGAT
CCAGTGCCTTAGCCACATTGCCTCCCTTGTGGTAAAGCTGGacagccttctccatctctcgCTGTTCCTCGAAGTACAAAGCACAATCAAGCATATCGCT
AGGTTTGCTCATGAGTGCAAACCCCATGAGGTCGGCATCCATTCGATGCTCCTTAGCTAGGCGTATGGCGTGATTGTAGCAACCGCCACTCGCGAAGAAG
TGTATCGCGTTTGAAATTTCATTGTGTGCTTCAAACTGTCGTGCGAGGTGATACGCTGCCGCGCGATTTCCACTAGTCTGTGCCACCTTCGCTGCCGCCT
GAAAATCTTTCTTAAAACACAGCACGCGCACGATAGACAGATAATCCTTGGCACGCTGGTAGCTGTCTACTGCGGCATCAAACTG