Description :
From Genome Similarity Track
Location :
scaffold_733:5830- 7158
Sequence
1328 bases(100 bases per row)
AGCTAGAATAGGGTAGATTTAAGACTGAATATATTTATAGTTAATTACCTTAATTTGGCCTGTAATACAAATTTGTAATTAACTATAGTTTGATCTATAT
AAACGTGGCCAGACCTCATTGGTTGGCTCTCAGCCGTCCTGGCTGGTGTCAGTGGTGTAATGTACACCACCGATCCGAAGTATCCCTTAAGTGGATACGT
GAAGTTGTCTATTTCGTGCGGGTGTTGGGTCACCCTAATGTAACCCCGTTACAGAACCTACACCACCAACTTTGCCGGACCTAAATGTTGGGGCTCAATA
GTCGATTGTATTGCTTTTGTCAGAATATATAACGCATACGTGCTCAATTCAAGAATAACGTTCCTGCGCGTACTATTCGTTTTGAACACACATGCGTTAT
ATGCACGGTAAGACGGTAGTAATGTGAGAGGAATTTTATCAAAAGTATCATTAGCACGTTTTTGAGATTTTTCAAAGAGTACCACAGAGCAAATGAGTGT
CGTTTCGGTTTCCCATAGCGCTATGGAGCAGTCCCAAACTCGAAGTAGAAGCGCAGTTATCGTTGGCACAGTTCAGACAACCGGTCCCGAAAACGAAAAA
TCTGAAAATATTTTCTTTACATATTCTGAAAGCTGAAATCGTGGTCTTTCTAATGGTCTTATCAGAGGCCTTAAAATCATGCTAGAACGATCTGATAACA
TTCCAAGAATCTGAAGGATTGCATTAAAGAAAAAAATTAGCAAAAGTATCACTATTTGAATATACCCATATACTAAACGATAGCCTCTATTTCCTTGATG
TCAGGGAGACGAGGGGGTCACCAGCATCACTGGGAGGAGCGGTGCCGTCGCCACTTAAGCTGCTATCGGCTCCAGGGTCTTCAACACACTCTCCGTTGCT
GCGGTCGTACATGCTATTGTGGAAGGTCGATTTGGTTTTGTTAGGAGAACAGAACTACTCACCATACACCGACTTTCCGAGGCCGATTACAATAAACCTC
AAACAAGTGTTAGTGATACTTTGATAAAACTCCTCTCATATATATTATTGATAACTACGGTCAGCTCATCCACTAAATAATTACCTACCACTAAGATGCC
ATATTTATTTACTACGTATTCACTAATAGCCTGTGCATAACCTCTATGGCTTAACATACCCATTGGATTATCTCTAGTCTCGAGCAGTTTGAGTGGAGTC
ACCGTAGTGGTTACTGACCTTCAATCATTGAACATCCCAACCGCGGATGCAAAAATGTTACTCCATGACATCCGCTCTTGATAGTAGTGGTGAGACGTAG
CGATGTAGCGCAAATGTCTATCCATGAC