Description :
From Genome Similarity Track
Location :
Scaffold_542:583- 4676
Sequence
4093 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCTGGCTCATCTTGCATCGCAAGGTCCAGAGGCGGTCACTG
CCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCGTCGATGACGCGTGAGGAGTC
TATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGAGATGGCCATGGGA
TCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGCACTAACGTGCGGCACGTCTGTTG
ACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGTATCCGGTCGAAGTTCCTTGCTAC
CCGCCAGGGTAAGAAGGGAGTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGGACCCTCTTCCAGAACTGGTCAGCGTGA
CCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCCGTGTACACCCTAACTCTTTCAAAGAGGCGGTGAATGTGCCATTAAATG
CCGAGCACAACTTCAGGTCGGCTCGATCTGGTTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACCTCAGCTATGCTGAAGATGA
AGAAGTGGAGCTTCTTGCTGCGGAGCAGCGTGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCATATTGCCCTCTGCGCAAG
AAGCGCGTGGCTCCGGCGAGCCAACCTCCGGGTCATCGCCGAGAAACGGCATTTCCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGATCTGAGTTCTGTT
GTACCTCGAGGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAAAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTTCAAG
CGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGAATCGGGAGCCTCGGGCAATTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTGTA
TGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGAAATG
AAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGAACGTCATGAGC
CATGGATCGACTGGAAGTCGAAAACGCTGGGTGTTGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAGC
GCTTTTGGCGCGAGCACGAGGCCGAGGTGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTACTGTTTGCCCTGAGGGCGTACG
TGGTGCGGCACGTTATCCGCTGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCTACTGAGT
GGTATGAATCTGGTCGATGGCCTACCGCTGCGTGACCAGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAAGAGATGCAGGTGAAG
TGACACCTAGTTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTGC
ACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGAGAGAGGAGAAGAAGACGCAGGGCGTCTGTGACGTCT
TCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTAATGAACGGAGTGACGGGGGAGGTAG
AAGGCGATATCATCCTTGATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCCTTAAAGGCAGGCGA
GCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCATGGACGACGCGGTCCTAGATGACACCAAGAAGGCGCTGAGCGCA
AGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCCACCGACGGGCCTGC
CTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCAT
TGACGCGTTTTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCCGAACGGCAAG
TGGCGCATTGTTCATGCTTATAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGCT
GTACGTTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTAT
GCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCCACCGGGCGTACGCT
CAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGCA
TGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTTACGGGC
AGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATTACTTGCACAAGTAC
AGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCACGACGGAGCCTTTGAGGCTG
TGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTTGCAATCGGTTGTGC
TTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACTATCCAGTTCATGACAAAGAG
CTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCATGCGTCGTTACGCACTGCGA
CACAGTCGCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATC