Description :
From Genome Similarity Track
Location :
Scaffold_2380:583- 1845
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2380-snap-gene-0.2Sodium/hydrogen exchanger

Sequence
1262 bases(100 bases per row)
ACCTGAACCTCAGCAACAACCTCTTCTTCGATATTCTGCTGCCACCGATCATCTACGAAGGCGGCTTCTCGATCAAGCGCCAGGCCTTCTTCCGCAACTT
CCCCGCCATCATGAGCACGGCAGTCTTTGGCACGGTCATCGCGACGTGTGTCACGGGTGGTGCGCTGTACCTGGGTGGAATGTACAAGATCGTGACACCG
CTTTCGTGGGTCGAAGCGTTTCTCTTCGGCTCGCTCATTAGCGCCGTGGATCCCGTCGCAACACTTGCCTGCTTCAACAAACTCAACGCGCCACCTCTGC
TATTCAATCTCGTGTTCGGCGAGAGCGTGATGAACGACGCCGTTGCCATCGCGCTGTATCAGACGCTTGCCAAGTGGGAGCCGGATATCGACCTTAGCGC
GAAGGAGCTGCTGCTCGTCGCCGCGAACACCGGCGGGATGTTTGTGTGCTCGCTGCTCGTCAGCATGGCCATCACGCTGCTCGGCGCGTACCTGCTCAAG
CGCAAAATGTTTGCGACTCTGCGGCACTATCCGGCCTATGAGATCTCGTTGTGTCTCATTTTCAGTCTGCTCACGTACTTCATTGCCGACAGCTTGCACC
TCAGCGGCATCGTTGCACTCTTCTTCTCTGGTACCATGACGGCGCACTACCACTTCCACACGATTTCCAAGTCGGCTCAGCACTCGTTCACACACTTGCT
CCACACGCTGTCCTTCATCTCGGAGAACTTTGTGTACCTCTTCATGGGCACTTCGGTCGTCATGCTCTTCGCGGGCCACGTCGAAAAGAGCGCTGGTGCT
GCGCTCCGCGTAGATGACATTGACTGGGCCTTCATCGGGCTCACTTTGCTCGCGTGTTTGGCTGCTCGCTTCCTCAACATTTTCCCGCTGCTGGGCCTCT
CGAACTGCACGCGACCACCGGCCGACAGGATCCCCGTCAAGTACATGTCGGTCATTTGGTTCGCGGGGCTGCGCGGCTCGATTGCCTTTGCGTTGGCCAA
GAGCTGGCAGTACAAGGGTCTCGACAATCATTCCCACAAGAAGCTCATCGAGTCAACGACGCTCATGATCGTCATCTTCACCACGCTCGTCATTGGTGGC
TTGACGGGGCCGCTGCTCATGTGCCTGAATCTCGCAGACTCGTCAAAGCGTACTGAGCTATCGACGGACACGGAATCCAGTGCGAACGAGAGCCCCGATG
TGACGCGCCCGCCCTCGCGCTCCGGCTCGAACACGCCCGCTCGGCGCAAGCAGCGCGGCTCG