Description :
From Genome Similarity Track
Location :
Scaffold_24:58294- 60326
Sequence
2032 bases(100 bases per row)
CTGCTGGCGCGCGGCAGTGGAGCTTCCAGGCGATGGTGGTGACGAGCGGCGCGTCGGAGCTCGAGACCGCGACGACGAGCGAGCTGCTCAAGCTCATCGC
GAGCGACGCGCAGCTGAGCTCCTGGACACGGCGCTGCTCGTACCGCGTGGTGTCTCGAAACGACGTGGAAGCGCTCGTGCGCCGCATGAAGGTGGAGCAA
CTGCTGGCCGCACAGGTGCAGCTCGAGCGCGATAGGGATGCGGCTGCTGCAGATAAGGAGGAAGACGTGGAGACTGAAGCAAGTGACGCGCAAGACCAGA
CACTAGACGCGGCATCTTCATCTCTACTAACCACTGAAAATGCAAGCTTAGCAGGCAGCAATAGCCAAAAGGCGATGCTGACGACGTCTGAGGGTATGCT
GCCCACACTGGAAGAGAACTTGGTCATGACGCCGCAGCTGCTCGCTGCAGCGTTCCAGCGACTCGTGCTCGACGATAAGAAAGAATTTACGGAGTTCATT
ACGGTGAACGCAGCACTGAGTTCATCGCCACCGGAAGACGAACAACAGGCCGAGTTCTTGATCTCATCAAAAGGTGACGAGCTCACGAGCAGCTCTAGTG
ACTCGACCAGGAGCTCCTCTACGGATCTCCTGAGTGCCTTACCAGCTAGAGAAGGCACACCAGCGCGCATTTACTTTTTGACCGAGTACCCGTCGTCGCT
CGCTGAAATGCACGCGCTGCTGCACACGGAGGGAGCGGGAACCATAGTTCAGGACGAGCTTCCGTTGCTGCCGCTGATCGACGGCGTGCTGCTGCTCCTG
GATCCGATCAAGGAGCTGCAGGACCGTCGGAAGTCCATCTCTCTGCCCAACGATCGCCGTAAGAGCGTGTCCCAGAAGAACATCGCGGGACTGGAACGGA
AATTCTCGCTCGTTGACGTCGACAGCATGGGTGAGCTCGAGAAACTCAATCCGGCCACGGTCGGTCCGTGCGTGTTCCAGACCGTGAACCCCGTTGTGTG
CGAGTGGTACGACGCAGCGAGTGTAGGTGGGCTCGAGTGGAGTGATTTCGTGTTCATGGACCTCTCTGTGCCCCAGCAAGCAGCTACGAAAGAGCTCAAA
GTGCTTGTAGAGCTGGTGACCGGCATGCTCACGAGCACCGAGACCCTCGCGGCACAAAAGCGCGAGTTCAAGGCGTGGGTGTCGACGACCAAGGTGATCC
CAATTCCGAAGGCGTGTCTTGGCAGTGAGGATGAAGGCGACAATGAAACTTCTAAGACGCTCACCATATACGAACAGATCCTGGCGCCAGTGTACGAAGC
GAGCGTTGGCGTGAGCACAGTAATCTTTGCGATGAAAGAAGCCATCGCGTGCTTTGGGGAAGGGAATGACAACGTCGTATTGAGCCAAAGCAACGACGAC
AATCAGTCGTACATGGAAGAGTTTCTCACACATAGCGACAATGCTGCCTTGCGTCTCGCCGTCGCATACACCACGTTCATCATGCAGCAGCAAGGACACC
ACAATAGCAACAGCAATGCACCCGATCCGCGCTGCATCCTTGGCACACAGATCGATGCCGTGGAGAAGGACATGTGGTCGCACAGTGACCTGCCAGGCGT
CGGTAACCGTGGACGCAAGGGCATGCCAGTCGCACCATTGGTCACACCAGCGGATCGTAGTGTCCGCGATACCGAACTCGCGCGGTTTTCATCATTAGAC
GTCGCCCAAGTGCATTTGACCCAGCAGTTGCTGCAATTCGAGGAGCTACTGGGGTCGCCATGGAAGGGCAAACTGCAGTCCTCGCGGTGCTTTGTCGAGC
ACCTCGATCGTCCCATTCTACCACAACGACTGGCGCAGATTCTGAGCAATTTCCCAGCTATTCACAAACACTACGACGCGTCGACGGACTCGCTTCTACT
CGCGACATTGGCGGCAACGGCGCCTGGGAGGTTCCGCACGACGCGCTGGACCGCGAAGCACCATGTTCGCCATCGTGTCGCATTCAAGGACTGGAAGAAA
GAACAATTGGTACCCGATGAGTATTTGACTCC