Description :
From Genome Similarity Track
Location :
scaffold_5:582802- 585104
Transcript NameFunction/comments
g8221.t1 conserved hypothetical protein

Sequence
2302 bases(100 bases per row)
CCCTTGCGAACTGTCGCTCCAATGGCCCGCGCAGCCGCTGCGCTGCCGCCAGCTCCAGATCAAGATCCAGAGCTCCGCCCGCCACGTGGAGCTACACGTG
GACGGCACGAGGCGCAACCTACTGGGCGAGGAGGAGCAGGGCCAAGTGTATCTCGGTACCTTCCGGGGCTCCAAACAACCTTCGGATCCGCTGCTCTTCA
GCATGTCGCCGGTGTTCAAGCAGAGCGATCGGGACTGCGACGTGCTCAAGAGTTTGCAGACGCTCAAGGTCAAATTTGTGTCCTTGACGGGGGACAAAAG
CGTGCTGAAGTTGCACGAGTTTCGATGCATTCTCGTGCCTATAGAGCCTGTTGCTGCAGTTGATACGAGGTAGGATGGTGATTTTTTTTAAGGCGGTGAA
GTGATTGAGGGTATTGACGGTGGTGTTGATGTTGACAGAGCTGCGGGATTGGCGGCCAAGATGGCTGCACTTGGGATGGGTGGAGCTCCGGACGCTGCTC
CGGACGTGCAGATGCTTCTGAAAGGCTTCCAGCAGACGCTGGAGCGCGAAATGGAGACCAAAATTGCACGAGTGATTGATGCAAAGTTGTCGACGCTTTC
GCAACGATTGGCATTCTCGGAGCAGGCACTGTTTCAATTGCATAAGAAAATGGACGCGAAGGATGCGAATGTGCAAGCGAGTCTAGAGCAGATCCAGCAC
AAGTTCGCGCAGTTAGAAACCCAGTTGAACGAGTTTAGCGCCACGAAAGAAAAGGTGAATAATGTGGACGATGTGGAGATGAAGGCGACGGAAGAAGAAG
CAGATACGGAAGCGGAAACAGCAGTGCCGGCAACTGAAGGCGAGTAACCAGGCCAACGTTTTTCATTTCTTTCCCGTTCGAGGCAGCCGCCTACCACCGT
CTTGATTCGTGTGCTGCAACCATCTCATACAGAGCAGGTTGCGATATCGCAGGGTGTCGAAGAGATTTGCGTACGTGTCGAACGATTGGGGAGTGGGGAA
AATCCGCTTGAAGTGTCCGCAGCGATGAAGCTCTTCCTCCATCTCTTTGATCAGCTGGAGGTCTTCGCCTTCGATCTGAGACAGCATTAAACTGCTCGCG
GATCCTTGTAGCAGTCCTTCAAATGTCCGTCGCCGCCGTTGTGCGTCCTTTTCCTTTTGGAGAATCGTCGGTGTGACCCCCGCGCTCAATTGTCGAGGTT
GCTTGATTCCATGTAGTCGGTCTTGTTTGGCCTTATCGAGCTGCTGGGCCTCCCTTTGTGCGTCCACAAACGGGATTCCTACAAGCTGGAACAAGTCGCT
AACGAGGACAGTTTTGATGCGTTTGTCCATCGGCGACGAGCTGCTGAGAGACGGAAAAACATTGACCTCCAGTAGACGGGGCTTCATGCTCTCACCTTCG
AGCAGCACATCGAATCCGTACAGCTCGAATCCATTGCGTCGACAACTACTGCCGCTGGAGGCCGACGCTAATTTATCTTCGACTGCAATCAGCGTTTTGA
CGATCAAGTCTTCGAGTTCTTCCTGGAAACTCTCAAGCTCACGAGTTTTGCCTTCGTCGCAAAGGTATTTGAAGAGCATCTGGAGACTCCATTTGCTACT
GGAGAACGCATGAGCTTCGATATCATCTTGATTTTTTTGAAAAGCTGCAGCATTTTTTGTTGTTGATGCTGTAGTTAGTAAGGTGGCCAAATGGGTTCTG
CAACTCGCTTTTGCTTGTGGAGTACTTTTCCGTGCAAAAGCGTACCAAACCGTCGTGAAAGAGGTGGATACGTAGAGGATCGTACGATGTCACCGCGACG
TAAACTCGGAGGTCAAACTTGAGACCGTTGATTAGGAACGGATTGGCAACGTAGCGCTTCACAAGTTTGAGGCCATGAGGAAGGGAATACGATAATGTCA
GAAAATGGTGATTCCCACTGAATCTGAAAAGGAAAATAGGGAGACATACCTGTACAACGTACGCTTTCTTCTTCGAGAGTTTTGGGGCTGCATGAGTACT
CGCCGACACGAGTTTGATTCCCCTCCCACAAGACAAATTAGGCGGCTTGAGAATCCACACAACATTTACCTCAGCGTGAAAGCGAGACAAGAACTGCTGC
TTATCGTAGTCGTTCGCTGTGAGATACGTCTCCGGAATAATATCCGCATAGGCGGTCGGGTGTTTCTTTCTCATACGCAGTAGGTGAGCACACAAGCGGT
CCTTGCGACCTAGTTCGAAGCTGCCTGGAAAATGGTTTACACGCTGAAAAGGCAGCAATGCACCAAATTCTTGTGCCTTGAGATGTTCACCCCAGAAAAT
AT