Description :
From Genome Similarity Track
Location :
Scaffold_136:58271- 59623
Sequence
1352 bases(100 bases per row)
CACATTAAGACAACAGTGTGTGGTAGTTCTCGTGTACACAAGCGTTAAATTGTGCTTTGTCAGCATCCATCATTACAAATTGTGGTGCAAATTGAACACC
AGCACAGTCCATGCACACACGCTTCAGGTATCTGATGCACCATCCGATGTCTATCGCACGTTTTTGCGAAGTGCAAAAGTATACCAACGGAAAAAAGTGC
CCAGCGCGATCCGAAAATCCAAAAACAAAAACCAAGTAGCCGTTTATAACCATGCTGTGCGTACTGTCAATGTGCAAAATTGAAGTGAAATCGGGATGAG
TCTGGCCGCAAGGTAGCTTCGAATTAGACGTAAACAGGTCATCCCTACCCGAAGAGGGTACGCGACCGATCCGTCACCAAGGTGCGAAACAGTCCCCTCT
GCACCGGGCCCCGTGTCGCGTTGAGAATCACATAAAATGATCATTGCTGTGTCTGATGTCGTCTCTATATCAATTTGGTCATAGAGGTGACCATCACACA
GCTCTATCATCGGCGCCATAGAATCTTTAGGATTCTTGCGTCTCCAGTTCTTAACGAAATCTGATACTTGTGAGCTAGTAGGAGCTGGACCATCGAAATT
ATTCTGGTCAACCAGTGTACAGATAAGCGAATGTAGACGTGAAGCCGTAGTTTGCTCTCCAGCTCCGAGGCTGTCCGTAATGTAATCTTTCATTTGCAGA
GTAAGCTTGCTCTTTACTGGTGTTGGGGGGTCATCGGTGCCCATCGCATGATTGCCTTGTTGAAGCACCTCACACGTGCTAGATGACAGACAGACCTTGA
ACTTGTAGCGACAGGGGCAGGTGCGGTTCGCGTTCAACGGCGTGTCAGTATCAGTGTCGGCAGCAAGCTGCAGGCGTGACTTGCAGCGCTCAGATTTACA
CAGAGCAAGTTGTGAGCGCATTTTATGGCCACATCGGTGCAAATCGTAGTCTTGATCAATTAAATGGTTAATCGTACACCCTACTGGGTTGCTTTTGTCG
ATACTGTGTGGTGGTAGAGCTGACCGATATCTTTCTGAGCGTCTGGTTCTGTAAAACGCCAAATAGTAGTCCAGGGTCGCCGCGGGCGAGATGCAGAGCC
GTCCTCCACGTCGGACTCCGATGAATCTAGCTGTAATGCCCCATCTAAAAGATCATCGTTCTCACTCTCCATTTCTTTGTCTCCACGTAATTCTAAATGA
GCGACAGTGCGATGAGCGTGTAAAACTATCTATTTCTGTATCTACAACACTTGGCAGTGATCATGCTATTTTGGTGGTCGTTCATTTTAAGGTGGTGGTG
GTGACCGTTTTCTGTGTGTGTGGTCCCGTCCATATTTTGGGTGGATCTACAC