Description :
From Genome Similarity Track
Location :
scaffold_68:58262- 59395
Sequence
1133 bases(100 bases per row)
CCGGAACACAAGGAATTGATCGATCGCTTCCAATCTCCCCCTGGGCACAATTGCCAGATTCGTTTCCACATCGTCTTCGCCCGATTCCATATAGACATCA
TCAATATCAAATAGCGGGTCGCACTCATACTCGGATCTTGGATGCTGGGAGATTGTAACTAGTGTCATACTTGAACCGCTTGGAGGCACGTTAGTTGTGT
CGGTTCCAGTTTGGTCGAAAATCATTGGCTCGACATTGCTGCAAGTCGATACCACAGGCACTTGTAGGCAATCTTcactcttcatcttcatcttaaTCCT
CATCACCATCATCTTGCATACGTTGAGAGCTTCGATCACCACTAACGACTTGCACGTACTTCGATCTTGGTAATTCTTGAAACACAGCTGAACAAGTTAT
TCCCACTCGCTTCATCTCGAAGTTCCATACACGATATCCTTTAACTTGACCTGAATATCCCAAGAACATACACTTGTATGTTTCCTTGTTAAACTTGACA
CGCTTTACCTTCTCAATGTGTGCATAGCCTAGAGCTCCAAAAACTCGCATGTGTGAGAGATTGGGTCGCAAACTTCCAACGGGGTATTTCTTTGGGTGGG
CGGCTCACGGAACTCGGTTGGTCACATATACTGCAGTGTTCATAGCTTCGGTCCACCACTTCCGTTCAACTTGCATATAGTTTAGCATCGATCCTGCTCG
CTCCGTAATTCTTGTGTTCATCCGTTTTGCCATCCCGTTCGGTTGTGGCGAATACGGAACCGTTGCTTGGTGAATGATACCGGTCTTTTGACACAATCTA
GCAAAACGATTGTTGATGTATTCGCCACCATTGTCGGTGCAAATACACTTGATCTTGGCACCCAGTTGATTCTCCATCATTGACCTGTACTCGATGAATA
AATCCATCACTTCCGATTTGTGGGCGATATAGCACACCGTAACGAGTCTCAAAAAATCGTCGATAACGTTACGATGAACCTTGCTCCACCTTGTGACTTA
GTCTTTATCGGACCCATCACGTCGCTGTGAATGAATTGGAGCACTGAAGTGGTCTTCACTTCAACGTAGCTTGACTTCGGGAACGGCTTTACCAACGATT
TGCCATTTACGCATCCTTCACAAATGTCATCCT