Description :
From Genome Similarity Track
Location :
Scaffold_1579:5824- 7132
Transcript NameFunction/comments
Phypl_g13751hypothetical protein

Sequence
1308 bases(100 bases per row)
CGCGGCCAGGTTGGGCAGAGCGACATCTCCCGTCGGCAAAGTGACCTGGTCATCTTGGAATCCCAGCGTCCCAGCCAATTCAGGGCTGGTGCTCCCTCGG
GAAATTACATCAATGAAGCCGCCGCGGATCTCCGATCTTGAGTCGTACGCAggcgtgagcagcgcctcgcgcagAGCCCGGTCTTGGGGCGACAATGCGG
CAGGGGCGTACCAGCGCTTCCCGCGAGATCCACCAAGGCCTGCGCGTCCGCAAGCTGGGACACGACACCGTCCGCTGGCGGACCCTGTGGAACGCCGTGC
AACACGGCCGGAGGAGCGACACGCGCCGGAGGCGCATTGGCCGGAGGCGAAGGCTGAGCCGAAGTGCTCATCGACAAGGCGGGTGAAATTGCGGAATGAG
CGATCCCAAAGAGAAAGGACTTTCCGTCTGGGACGGGGCGACGCATATCACAGACCATGCCAGGTGTCAAGTCCCAAGAAGGAAAGTTCTCAATCGTGAT
TGACGGATACCGACCACGGCGGCCGGACTCTGACCCAGGTTCAGAAATGACCACCAGGACCAAGAGTGACTCGGCCGACGGCTCAAGGAGCCAGACCGAT
GCTGATAGGTCCCGGGATCCCAGAGGCACGGGTCAAGATCCTGAACCCCAATGCCTCGAACAAGTCTCGGCATgtgcgctccagcatggGGCGGTTGTGA
CATAGTGCGCCGGGGTTCCCGGGGAAGCCGACCAAACCAGCACAATTTGGTGAgcccgaagaagccaagtcTCCGCGTACAGTGGTCGTCCAGTTCCCAA
GAGGAGAGCCTCAGagaggcagcacagcacggctGACGACCGCAGACAGTACGGCcatagtgtagccaagtcAGGCCATAGTGAGACCAAGTAGTTAGGC
AGATCCCAGGATCTACCATATGTTAAGCGTCGCCCGAGGCCTTCGGGCAGGGCGATGCTCaattcagtcttacttttccCCTCTGTTCATGACGTGCGTG
GCGCTAACCAACTGTCACGTGTATCTGAATCCTCTTCGGTCTGCAGATGGTGCCTCCTCCGGAAGTATCTCGGCCGCATGCTATCGATTGGCAAGGAGGT
TGTCTCGAAGCAAAATACATCGCAAAAGCGCTACCGCAGCCGACGTGAATATCGCCTTCGCAGCATATTTCGTGTCCGCCACGACAGCATGAGCGCCACC
GCAATGACAGCAGTTCAGCCGAAAGCGACGAGGCTGTGCATGACCTTTCAGCTCTACCGGATCTATTGTATATAGGGCCTCGTAGCGATGATACCAACGC
CACTCACC