Description :
From Genome Similarity Track
Location :
Scaffold_15:58233- 70078
Transcript NameFunction/comments
Phyta_totarag956hypothetical protein PHYSODRAFT_345503
Phyta_totarag957hypothetical protein PHYSODRAFT_313206
Phyta_totarag958hypothetical protein
Phyta_totarag959hypothetical protein PHYSODRAFT_354319
Phyta_totarag960conserved hypothetical protein
Phyta_totarag961putative malonyl-CoA decarboxylase
Phyta_totarag962hypothetical protein PHYSODRAFT_313210

Sequence
11845 bases(100 bases per row)
GCAGGGAATTCCTGAGTGAGCCTGCAATCATGCGCATTTTCATCCAGATCGTTCTAGCGCTTCAATACTTGCACGGAAACCGCATCCTACATCGGTACGC
TTGAAAAAGGAAACCCTGCTCTAATGTAATGATCAACTCATGGGTGGTGCTGACAGCTTGGTCACTTTTGTATCATAGAGACCTCAAACCTAAGGTGTGG
TACAAGCTTGGCTCGGCTATTAGCGGCAGGAATTTAACATTAACGTTATGCTTATCGACTCACATCCTCTTGCCAGAACATCCTGCTGGATGGCGACGGG
ATCGTAAAATTGAGTGACTTTGGCGCTTCAAAGCTATTGCAGAGCTCTTTGGACTCAGTTCAAACCATCACTGGAACCCcgcactacatgtaagttGGAT
TTTGGTCACACTTCTTGTTGAAAACTGCTTTACACGGCTCGTGCTTGTTTGCCTTTACATGTAGGGTGCCCGAACTACTCGACGGAGGGTCATATGACTG
CAAAAGCGACGTGTGGAGCCTTGGTTGCGTGCTTTATGAATTCGCCACTTTTTCCCCGCCGTTCACCGGTTCGGCCCTTGGTGCCGTAGTGGGTAAAATT
CTGCACAGTGAGTTGCCGCCAGTATCCCACCAGTTCTCTTCGCCGTTTCGGCCTCTTGTGGCCAAGTTGCTCGAGAAAGACCCAAATGTACGACGAGCCT
ATCCTAATCAACACTGCATTGTAAGTATATTCTAACGCGTTGCATCGTGGTGGCGTGAAATGTGGCAGCGTCGACCAAGCTTGTCCGAAATCCTTGGTTG
TAGTGCTGTTCAGCACCACATGATACAATTGGTGAGCGTCGCAACATCACACCAGCCCATGCTCCTGGAACAGTATGCTGCGAAACTCAAAAACTGTAAA
CATTCTCAAAACGCGTTGGTATCCCCACTTCCGAGTTGCGAACCTTACCACAGTGGCGGCAAACTTAATGCCCAAACGAAGGAACCAGCCACAGCTGCCA
GTCCGCCGAGGCAAAAACAACCGGAGGCAGACCATCCTCGCCTGCTTTTCTTCGAGAGCCAGGTATGAACACACTGTAGCTACGAGACTACTGACCCACT
GATCGTGTAACTTGACGCTCGCATTCCTCTAGGCAGCAGCCCGAAGAAACAAGGAGCGCATTGACCAAGAGAGATCGCGCGCAGCAGTTTTTCTTGACTT
GCGGTGATGGTGAGCCACTCGGCCAGCACGCTCAAAACACGGAGCAGAGGCCGTCCAATCCGACCAGCGGTAATCGACAAGTTTTCCTCACTGACAGAGT
GCGAGTTTCTAGCCACAGTCAAGAGGTATTCGAAAGTCTCAAATGTTCTGTAGCTGTAGGCAAGCACGGCCTGCCGCCGCCTGCACCTTTGTCGCTTGGT
TCGCCCAGACGTCGAGCGCAGTCCTCACCGTACGTCAAGAGAAAATTGCTGCAACTAATTGGTTCCTGACGAACTCTCATGATGCATTTCCCAGGGCGAA
CTACGAAGAGCTCTTAAATGCTGAACGACGTCGCGTGTAGGTCGAGaccaaggcgctgcaggaacgAATGCGGGCGATGCAGACTGcagagcacttcaac
ttggtcaATTAGTGACGATCCCTAAAGAGTGACATaaggagaagctgatcaattctcttcctctccagcatgacgaaggccaagcagttcGTCGAGTTCG
GGTGTGTGAACGAACGAACGCCTGGATTTCTCGTTAAAACAATTGACCCCTCTTACTACTTAAACCCTTCCTGGTGGCACctacagcaagaagatcgtTG
CGATCGGGAAGAACTACGAGGCTCATGCGCGCGAAATGGGTGCAGTCTCGGCCCCGAAAGACCCCGTGCTCTTCCTTAAACCCACCACTAGGTATTGCGG
TAATACCATTTTAAGACTCTCTGTATAAGGAAGGAAGGAATTAATGACGTGGTTGGGGACGGGGATTACGTTGGAGTAGCTACGTGCGCAATGGCGGCAG
CGTGCTGCTCCCCCCTGGGATTGGTGAAGTGCACCACGAAGTGGAGCTCGGTGTACGTTCTTGGTCTCTTGCTGCCCTATATGAAGATGGTTAATTGCGT
GGAATGTCTTGCAGGTGGTGATTGGCAAGGGTGGTAAGGATATCGCTGAGAGCAACAGCATGGACCACGTCGCCGGCTACGTAAGTTCCAATACTCGCTC
CGTGAACTTTTGTGAATTGTGCTTTAGCTTTTATGATTATCGTTCTTTGGTAGGCGTTGGCGATCGACATGACGGCGCGCGATCTGCaggccaaggtgaa
gaaggcgggGCTACCGTGGACGCACGCCAAGGGATTCGACACGTTCACACCGATCAGCGACTTCATCCCTAAGTCGTCGGTGCCGTCGCCTCACGATCTG
AACCTCTGGctcaaggtggacgacgGGCTGCGTCAGAATGGCAACACGAGTGACATGGTGCACAACATCCCGTTTCTGATTTCTTACGTGAGCCGCATCA
TGAcgctggaagaaggcgaccTGCTCATTACCGGCACGCCCGAAGGCGTTGGACCCCTCCCGCCTAACAGCGTAAGTTTCTGCGCTTGGATTTTGCCGTT
GTATTCTACTACAGGTAGTAGTTTTTGATTGTCTGCGTGTTCCTTGACCTGGCTGCATACAGGTGCTTACAGCGGGTATCACGGGGCTTATTGACGTGCG
CTTCCCTGTTGAGACGCGCGTGTACAATGCGTAGAAGCACGCTCAGATTTTGTATCGACGCCTGCCAGCAACTTTCATCAAGCAATAACGATGAAGCGTC
GTGCAATATTGCGTTCGACCAACTTCGTGGACATTCCAAGCTCTTGCGTGTTGCTTGGTCGTAATACCTGGCTCGTGATAAACAGTTCTAACGTTGTTTT
ATgggtgctgtcgctgcttcgaCCAGCATGGACAGCTTGCGGAAGTTCTGTTTGCGCTTGCAACCGGCAAAAGTCGTGCGGACGTGCCAGCCGCGGTATA
TTGCCTGGATACGCAACGCCGCCGCATCATGCCGCAGGTTGCGTACAGTAGCCTGAGCGTAGGATCGCACCTCTGATCGATTTGATGGCGCTCTAATCAA
CCGCGTCAGGGCACCTAACACCCCACTCTCCACTAGCCTCGAGCGCGCCACGTGCAGCTCTGACACAGCCGCCAATGCACGTGTAGCTTCGACAAGCAAG
GCCTCGCCGATGCCTTTGTCACTGCTGTGACCAACTGCATGGCTTCGATCCAGCGGACTCACGTATCTCACAAGTACAGGCAGAAGTCCTGCATCCACCA
GCTTTAGTACGTTTTCCGGGCGCTCAGCGAAGTTGGCGATGATCTGGGCTACGTGGAGACGCGTGGAACCAAGTGGATGGAATGCAAACTGCCCCAATGC
TGACAGTAGCACGGGTTTACACAGTGTTAATCGTGAAGGAGTGTCGTGCGTGAGTTGTGCCAGAGCACCCAATGCATCCACTTTCATGCCAAAGTCGTCG
CCAGCTATGATTCCGAACAAGCACTTGACGACGCCACGCGCCAGAAGTTCGATGTAGTGCTGATAGTCGCGCTCAGAAGCTTGATGTGATCCTCGGGGAG
ACGCAGATGGACTTGACGATACATCATCTTCCGTCCCAGTTAACTGGCTGGGCTCTTTGCGCCGTTTGCGTTCGGTGCAGATCAACAGTGTGAGCAGGGT
GATGACTGCACGGCGGACACGCTTATCAGACGAAGCATACAACTCACGCGCTGCGATGTGCTCTATCAGCTTCGATCGAATCACGTGTTCTCGGTTTGCG
ATGTTTCGGGCCATAGCGCAGAAGATCCCAAGTGTTGCACGAACAATTGATGTAGCTTCGGAGGCTGGCCAAATAGATGCCGAGCGCAAGCGAGGGCGCG
TGGATGAAGCCGATCCAGGACGCGAATTCGGCGCTTTGGACCAAGCTGGTGTCTTTGATGCAGTCTGTGGGCGTTTCCTATCCGGATCAGCAACTGGTAC
ACCTCCGTTGAAAGTGAAGCACAGCTGGACAAGGCGCGGCATCGCTTCAGCTTGCACGAGTGCTCCGTGATTAGCATCGTCCTTcgcaacagcatcaaga
aTGGCAACCACCAGCAGACTCACTTGAAGCGATGGTCTAGTGGCGCAAGATGATCCGTGACCAAGGACGCTAAGTACGCACGGCAGAAGCCCAAGCGAAG
CAAAACGATGCGCATTTTCCGTCTCGGATAGCAGCAAATGCACGAAACTCAGCAACTCACGGCGGAAGACTGCGTCTTTATCCAGGAACGGATCTCGCAG
TAGCCCCGAGAGGGTCGTGAAGTGACCTGAATAGTAGAATAGCACCCTGTTTTCGCACGAGGCTGCTAGCTGATGCAACACTGAAGCAGCTAGGGTGCGT
GTGCGAGTATcgcctgctccaccacctctTGCGGTTTGTGGCGCACCACtgccggagcagcagctcagcatGAACGCGAAGCCTTCTCGTTTGGCCACAG
CCTCTCGCCACTCATCGGTTGTTACCAATCGTGCGACAACTTCGAAACCTGCAAGCCGCAGTTTTTGATCTGTAGTCGTGTGTAGCAAGGAAAAGACACA
GTCAATGCCTCCTGGTGCTTGAAGAAGCTTAGCCTTGATTGTAGACAGCCGAACAAGAGCAGCCAATGCATGCGCGCAGTCATGGGAAATCCCTGGGTCC
TCTCGGTCTACCGGTGAACTCAACATGGTCAGAATCGCACCGAGCGTGCCTACTTCGTCAAGTAGGTCGAGATTTGCGGCTATTACATGACATTCACGAA
AACAAACGTGAGTTAGCCAAGCGCTCAAAGACCAGGACAATGAAGAAACGTACTGTTGCGACTCAGAGAGGAAatcgcagcagcggcgtcgcGCCGCACT
TCCACAAATGGTGACCAGTAAATGATCTCAATCAGTGGAATCACATCATCAGCCTCAACGTCTTGACGCCGTAGGCTCTTGAGGACTTGGGTGCTGTGGA
GCGAATCTCGACGACGGTCGCTCTGCATGGCGTTTAGCTCCGCTTCTCGTGCTACTAACTGTTGCCTCTTGGGATCAGCACGAAGAGAAGCTGTGACGGA
TGCTGCTCGCTCTGGTGCTTCAACTGCATCGACTTTGGCGGGAGGTTGGAGTCCATCGCTGGCACGATGAAGCCGCGTTGCTTGTGAGAGCCTGCGATCT
GTCGGAGGGCTGGCCACGAAGCCCTGTTGGtccttcgtcgctgtctttgGTCCTGAGACTTGACTGTCTTCGAGCTTCCGGTTGCGATTCGGCTGTGAGT
CCTTCCGACTTTCTCTGCGTCCTGTGCTGGCTGGGGCTGATGCAATGGCGATGGCAGCTCGGAACCGCTCTCGAGGATCCTGCAGTGAACGAGCCGTCGA
CACTTCAGGTAGATGCTTGTCATTTGCTGCCACTGACGAAGGATCATTCCTCTTGGACGCCGCCGGTGAAGGGAAGATATCCGCTGGAGGTGCATTCCAT
CGGCGCTTGGCGACTGTGGCCGACCCGCTCCCAGGCCGGGAAGACACGGGCGTGCGTGGTTTGGACGTCAGAGCGGCCGGAGGCTTGACACTCGTCACCA
CTGGCATCTTGGAAGACAATGGTGAGAGGCGCCACCTATATTTACCGATCCATGCGCTGTTCTAAGTTgccgttgttgaagtggcttcGGTGGTCGACTA
TCTGTCGTTCTAAACGTTAAATCAGGTTTCAGATTCATAAAACCAGATTTAGAATAGCTGCaattgtttttttgtttttatcAATCATACTGATATCGTC
AACaaccaagtcgaagagctcaacgtcgccgccatgaagaagaaagtgcGTCTCGCACCTGCGCCTCTCTCGCCCAAGGCGCCGCTGCGGGTTGTCTACT
AACCAGAGGAGTGTCTGttgtctctctctctctctctgtgACGCAGGTTCTGTTGATGGGCAAGTCCGGCTCGGGCAAAACGTCCATGCgctccatcatc
ttcgccaacTACTTGGGTGCGGGGGACTGTGCTACCTGTAATAACACAGCTGCTCTATGATCCACACTCTCACTCTATGCTCTCTCCTTTGTGATGATTG
AATAGCCCGTGACACGATGCGACTGGGACCCACGTGTACGTGGCCGACCCAAATGGATCCTTGGACGAGGCTTCATCCGTCGATATAGGAAGAGAATAAC
AGAGTTGTTtcggctgttgctgcttgtagtGGATGTGGAGCACTCGCACGTACGTTTCCTGGGCAACTTGGTGCTGAATCTGTGGGATTGCGGCGGGTAT
GGCGACTGGAGGACGAACGCTCTGCATGTGATACTTcctgaagctgaagctgttgtgtgtgtttgttgGTGCCCACTACAGCCAGGATGCCTTCTACGAG
AACTACTTCGAGAGTCAGCGTGACCACATTTTCCGCAGTGTGGAGCTACTGATCTACGTATTTGACATTGAGAGCCGCGAAATCGACGTACGAAGGGGAT
TGGCTGCCTTAGTGGGGATTAGCGTTGAGCAGGGTGATGCTGATTTCCGTATTGATTGTTGGCTCGTTACAGAAAGATATGGCTCACTTTGACGGCTGTC
TGGAGGCCATCGACCAGAACTCGAGCAACGCAAAGGTGTTCGTGCTGATCCACAAGATGGATCTCGTGCCGGAGGATCAGCGTGAGCGCGTACGTCACCA
TGTTCCCGTGGTTTGGTCATTGACGTGGTGAGTATGAGCTAAGACACTGGTTCTCTTTGCTGGTGTGAACAGGTGTTCAATCAAAAGAAGGAAATGATAC
TGGAGAGGACGGGTCAGCTTCCTACGGTGTGCTTTGGCACGTCCATCTGGGACGAAACGCTGTACCGTGCATGGTCGTCCATCGTGTACTCGCTGATCCC
GAACATGCAGGACCTCGAGAAGCACCTGaacagcttctgctcgatctgcagcgctgacgaggtggtgctgtttGAGCGTGCGACCTTCCTTGTGATCTCG
CACGCCACGCACACAAACCACCGCGATATCCACCGATTTGAGAAGATCAGCAACATCATCAAGCAGTTCaagctgagctgcagcaagacTCAGGCGCAGT
TCCAGGGCATGGAAGTTCGCAACTCGAACTTCACGGCCTTCATCGATTTCTTCACCGCCAACACGTACATCATGATCATCATGTCCGACGACTCGATCCG
TAAGTACCTGCCTACTATGCCGTGCCTGTTTTGAATATTACGCTGTTACTGACAGCTTTCATCTCGCTCATCGCGTAGAACCAGCGACGATCCAACTTAA
CATCAAGGCGGCCCGCCCCGTGTTTGAggagcacgtgcagcagacgAGCTAAGCAAATCGCCTACAGCAACTATCAGTGTTGTGCGATTGGCAGTACTTG
TCTAATGCCGATCCGACACTCAAGAGAAAAAAAATGCTCCACATTAGATGCTCCAGCTGGCGCTACATCTAACGAACGAACAGCTTCTAGCGTAGATTCA
AAACATCTTTAATTCCATGTACGCGCCAAAGTCTCTTCAGCGTTCGTTGGGGGCGAAATACATTCAATGAGGTTACTGgggtggtggcggtgggctggac
gacgagttggTCGCAGTCAGCATGTATCCTCTGCGCCTCAACGCACGTAGAACCACCGGTGTGACAGCAAACGTGAGTGGCCACCGAACGGGGGCCAGCA
CCTTGTAGAGCGTGTAGGCGATTAGGAAGGATCCGGCCGAGTTGGTCGTCGAGTCACTCGCTGACGTGGACAAGCCCACAGAGTCCAGGATGGCCGTCAC
GTCCACACCACTCGAGACTCCCACGTAGATGACGGAGAACGAAAGCAGCGATAGCACAATGTGCGTGCAGATGCCCACGCGTCCGTACTCGATGGCGAAG
GTCTTGGCTCGTTGTCGCCACgactgctgttgaagctcCTCCGCCGGTGGCATCAGCTCCGTCTCCGCGTCTTCTCCTgtctaccagcagcagccataAA
AAAATAGGAAACAAGAGCCAGCCACAATGTCAACTCCGTTGCAGCAACCACCTCCAACTCTTACAAGGGAGATCGCACCTTCAtcggcgacgaagacgtc
ggtTCTCCTCCCGTTAGCGGCGCTGTCTCCTTCGAGTCCTGGGACGTCCTGCCACTGGAGCAGAGCCGAACCATGCCACAGTTAGAGCCGTGACTCACAG
CAAATGGTGACGGGAAGCCAAGCAGACAGTGCGgcgcagcgacggcggcagctccagcagcaggtcgcggGGCTTGACACCAGATGGAAGAGGCGGAAGA
GACGCAGCTGCCAGTAGGGGCCACAGACGACAGCGATCGCGCCACAAGAAAGCGCACCCTCGCGCTGGAGCCGACACCGTGCTGCGCCACGCCTGGATAA
GCGCAAAAGTACCTCATTCCGCCGCGTAGCATCATAGAAAGAGACAGGAACGGATGCCCCAAGACGAGTTGATCACGACAAGCTCGATTAGCAAAGTGAC
ATTTTTGTATCAAAAGTCCATTGTGTAGTATACACTAAACACGACCGTTTAAGTCGGACATGGATCTTCAACGAACTGCCCCACATCTCACTTGAAGAGC
AGTTGCGATCGAAGATGCCTTCGGCTCCGATGCGAGGCCTCTGGGCGGCGCGCGGCTTGGTTCGACGCAACGTACATGGAGTATTAGCTGTCGAAGCATC
TTCCCGATTGATGTTGCGGTCGGCGGGCATCACCCAGCACGCGttcttcgccagcagcagcagcagtgagaGAGGAGGCGACTCCCACACGGAGCAGCGA
GCAGGCGACGCAGCGCTGGAAGACTCGAcgcaccagcatcagcagtcCTCGTTCCTGCGCAGCATCGACCTGAGCAACCCAGTGGCGCAGCGGAAACTGT
CCAAGCTGATCCAGGGGGTGGTCAAGACCAAGGCCAATACCGGCGGTGCGTCCCCCGACATGATGCAAAGAAAAAGAGACGGAGCCTCCCTTGACTTGTG
CTTGTCTGTGTGTGGCTCGTAGATTTCGTGCCGCAGGTGGTGATTCAGAGTCTGTGCACAACGTATCGAGGCATGCACATCGATGAGAAGAAGCAGTTTC
TGCTCATCTTGGCGCAGGACTTGCACATCGACACAGCCGTGGTGGGTATTTAAGTAGTGATACAGATGACGAGctttgcatttgctgctaTTGACTGACT
GAGTGATACTTTGGTTGCTGTTTTTGTTTTACTTTGAGTAGGCTCTGCAGAGCGCTGTGCAGTTTGAGCAGAACATGACCAACGTGAAGGAATCTCGTAG
TGGGGTGGTTGACTGGGAACATGAGAACGTGGAGAGATACTTGCGGACATTTCGCAATCTCCGCAACGCCCTGTCGCCGCTCTATGAGGTAAGAGATGCA
GTTATTGTGGTGATTGGAGAGTAGTAAAGAAGCTGACAATGTTGGTGCTTACGACGTGATAGACCTTTTTCCAGCAAATCTTGTCGCAACGAGAAAACGG
CATGTTATTCTTGGTACACATGCGAGCGGATCTactgcaagtgctgcgcaAGAGTGCGATCCATTCCGAAATCCCTGCTCTTCGCTCGCTTGACGCAAGC
CTAAAAGTGAGTTCAGATTTTCTTTCTTACCCCAGCAACGATGTGTTCATCGCATTCAATTGGCGTCTTTCTTTTCTGCATAGCAATTCCTGGCGTCATG
GTTCAGTGTTGGCTTCctgaagctggagcgtgTGACCTACGAACACTCGCCTGGCCAGCTTTTGGAGAAGATCATCCGCTACGAGGCGGTACACCCAGTG
GGCACGATTGCCGAACTTAAGAGGCGTCTGGGTACGTTTGTAAAAACAGTTTGCGTGGCTATAACGCGATATCTGTTGCGTTGACTTCTGGATACGCTAT
ACTTGCTATCGCTTTCAGGCAACGGACGTCGTTGCTTCGCATTTTTTCATCCTAGGTAAGATATCTGCAACCAAATTTATTGAAAGTGTAGTCTGATCTC
ATGAGGATACTTTTCTTCTTTGTAGTATCCCGGACGAACCCTTGGTGTTTGTGCATGTAGCATTGATGCAAGAGCTAGCGTCTAGCATGCAAGCAATTCG
TGACGAAACTGAGCAATTGACAGAAGCCTCCCAAGCAAAAGCTGCAATCTTCTACTCCATCTCTTCAACGCAAAAAGGACTTTCGGTATGTCAGGGCGTA
CCGTTTCTAATACTTGTGTTGTACGTTGGGCATCATTTAGCTAAATTGCCGTATCTGTTGGTGGCAGGGTGTGGACTTGGGCAACTTTCTCATTAAAGAG
GTCGCCAAAGCCCTCAAGACAGAGTATCCGCACCTGAAAACGTTCGCGACATTAAGCCCTTTGCCTCAATTTATGCCGTGGCTCGAAACACAACGGTACA
AGACTGATGAGTCGTTAGTATCCCcgctcgagctggacgctCTGAttgacgtgctggacgagcgtgGAACTATTGCCGAGTCGGACTCCACCGCTGTGGC
AATAGTTTTGGATGCGCTTTCGATCAAAGGCTGGAGCACGGATCCAAATCTGGTTGCAGTGTTGAAGCCTATCGTGCTGAAGCTTGGTGCGCGCTACATC
TACCATGAAAAGAAGCGCGGAAAGGCGCTAGACCCTGTCACAAACTTCCACGTCCGAAATGGCGCAATTTTCGAGCGGATCAACTGGTTGGCAGATCTGT
CCAAGAAGGTGCGTGGGCCAGCCCTCGATCACTTGGGTGCATTTCGCGTAGCATTTCCTCATTAAATTTGTTGGGTATTATTTTTTCATGCTTGGTAGGG
TATTTCTCAAAGCGCTGGGATGATGATCAACTACAAGTATGATCTGGCGCATGTGGAGGCAAATAACGAGAACTACTTGCTGCACAACATTATCCCCATT
GGGCTTCAGCCGCAGCAAGTGCTCGGAGCACGCACCATTTAATTGCAGGGCAGGATTGGCCCTTTATTTTGTATTCATTTTTTCACAGGGTAAGAATTGA
ATTTCAACTTCTTACCATTTGAGTGTCTCCCAGCCTTCATTTCGTATTCAGGCGCAGCAGAGCAGTCATTTTTGGCGTTCCGTGAAGGGTCGTAGTGATC
gcagcgatggtgctggcacAAGACGAGATCGACGCTTGTCGAGAGGCATTTCTGGCGTTCGACAAGGATCGGTGAGTGCATTACGGGTGGGTTTGTGAAG
AGTTTGTGGTCGATGACGTCGACTAACTGTGGCAAACTACAGGAGCGGCACAATCGATGTCTGGGAGCTACGTCAAGTGCTCGAAGGTAAGGGTAGCTTA
GACGGTGGTGTACTTGCACTTGTCTGCTCTGTGGAGCCAATGTACCATTGGTTTTAACGAGCTCGTCTACGGATTAGCAATGGGGCAGCAGCCAACTGAA
GAAGAATTGTTCCAGATGATCAGCGAGGTTGACGAGGATATGAGCGGCGCCATAGGTATTCAAGCTGCCCGCACCTTATTGCATGTAGTATCGCGAACTC
ACTATATCTGTATTAGACTTTGCTGAATTTCTGCAGGTCATTGACAACCAGAAAGATCGAGCTGCCATGTttgaagacgacagcgacatgAGTAGGACAT
TTTCGACGTGTAGTGGCACCCAGAGCTACTAATCATTGTCTTATCATTGGGCTTTACAGTTGATGCATTCGTTGCGTGCGGCGGCAAACCCGACAAGACG
GGGTTTGTACGCAAGGAGACACTGGTGAAAATCATCAAGGGTGACTTCGGTCTTACTATCAATATCGAGGAGATGATCAacaagctggacgtggacggTA
GCGGAGAGATCGAATTCGACGAGTTCAAAGCCATCCTGACGTGAT