Description :
From Genome Similarity Track
Location :
Scaffold_482:5823- 12148
Transcript NameFunction/comments
Pytve_DAOMBR484snap_masked-pve_contig_482-abinit-gene-0.4Dynein heavy chain

Sequence
6325 bases(100 bases per row)
GTGCTCGCGCTTCTACAACACGCCAGCGAGGCTCGTCGTACTTGTGCGCCAGATCTGCAACGAAGTGATCCGCAAGGCCATGGCCCACCTGAACGGCAAG
CGTCTCTTCGAACTCATCGAGGCGGACGACCTCGACCAAGCCAACGCTATGCTGCAACTCTCGCTGCAGGTCTGCGCTCATTTCAAGAGCGTCTACTTCG
ACTACAAGGCCAAATCCGTCGCCGAGGTACCGAGCAACCCGTGGCGCATCCAAAACAACGCACTCTTCGTGCGGCTCGACGCCTTCCTCGAGCGCTGCCA
CGATGTGCTCGAGCTCACGCAGACAATCGCTCAGTTCCAGAAACTCGGCCAAATGGAGATCGGCGGCACCAAGGGCAAAACACTGACCACGAGTGTGCGT
CAGATCCACGACGACTTCCAAGAGACGCTCGCGCACATGAAGAACGTGCACTACGACCTCATGGACCTCGACTCGAAGCACTTTGACGATGACTTCTACA
CTTTCCGCACGCGCAACAAGGAGCTTGAGCGGCGTCTTGCGTCTGTGATTAACCAAGCGTTCGACGACGCCAAGACGATCGCGGGACGGTTCAAGTGCCT
CGACTGCTTCGATGAACTGCTAGACCGGCAGATCATCAAGAACGAGCTCGAGCGCAAGCACATGGCACTGGTGGCCGCCTATGCGAACGACCTGCACGCC
GTCCAGCAGATCTTTATCGAGAACCGGGAACGACCGCCGATTCCGCACAACCTGCCGCCGTGTGCTGGCGCAGTCACGTGGTGCCGCGGACTCGCTGAGC
GAATTCGGTTCCCAATGGAGAAGCTGACCCAGATCTCGCCGCGAGTGGTGCTAGAGCGCGAAGACTCGAAAGAGGCCATGAAGATGTACACGAACGTAAT
GGCCATGCTGCAGGAATACGAGGTGCAGATGGTCAAACAGTGGGGTATTTCCATCGAGACGTCGTCCAAGGCCAAGCTCAAGTTGCCGCTGATCCGCCGC
GATCCCGTCAACAATTCGGGCATCTCCGATCCAACCGTAGCCAAGAACTCGCAGCAACCGCCGAACACACCTCAAGTTGCTGCGGGTCCGCTAGTCGTAA
ATTTCGACCCGGCGCTAGTGCAGCTGCTGCGCGAGGTTAAGTACTTTTTGCTGCTCGGGTTGGAGATCCCCGAGGACGCACTCGCGATCTACAAGCGCGC
CGAGGTGTTTCGTCGACAGACAGGCAACCTGGAGTTGATCGTGGACATGTACAACACGATTCACTCGACGCTGCTGCCGGTTGAGAAGCCGCTTGTGCGC
AACTACTTGGACCGCATGGACCAAGCTCTCAACAAGGGGATGAAGGCGCTCAACTGGAAGTCGCACGGCATTGATGTGTTTCTGAAGGAATCCATGACAG
ACGTGAACGAGGCAAACACACTATTGAGCCAGATGAAAACGCACCAGACGCGCGTGGCCGAGCTATTGGAGATGTGGAACGCTCCACCCCTGCTGTTCGA
TCGTAAGAGCAAGGCGCTCGCTGTGGCCGAGTTTCTGGAGCTGCAGCAGGGGTTATGTCAGCAAAAGTACCACATGATCAAGGAAGGTGGCAACGAGATC
CACCGACTGCTCAAGGAGACACTCAAGTGTCTACGTGTTTCCCAGGGAAGTCCCGACTGGCGAGCGTATGTGGATTACGTCAGCGGGATGGTCGAAGACG
GACTCACACGGGTGGTGCTTCAGTCGCTCGTCCATTTGAGGGACCAGCTGGACCCCAAACGCATCGAAAGTGAGGATCTGCCGGCGCTACTTGAATTGGA
GCTGGATTTGTACGGCAAGGATATTATCTACTTTCCGACGATTCAGTCGTCAACGGCCAAGAATGGTCTCCACGACATTATCATGGGGCGTGTCGAGGCG
ATCTTACACTGCGCGACTGTGTTCAAGCGTCTTGACAGCTCCGAGGGGTCGTATCTCAAGGAAATGCGCGAGAACATTCAGGTGCAGCTGCTGGTAGCCG
ACATTTCCTCCTTCCTGGACCAAAACGAGAAGGCTTGCTTCGCGTATCGCCAAGCGCTGCTCAAGTACGAGTACCTGTGGACGACAGATTTGCCGCAGAT
GTTTGCCAAATTCCTCGAAACCGCCTGGAATCCGTACCCGCACGGCAATTTGCCGGTGCTCACAGTCGAAGCGGATACATCTATTTCGTCTGATCAGGCT
CCGCCGTCGTCGGCTTCGAGTTCAACGCGACCGATTCAGCCGGGTGGAGGCGGGCGACGCTCGCTCGCTCCTGGAAAAGACTCGATTGCAACGACCACGG
TGACCGCTCCTATGCCAGCTCAGCTGTTGGAGCTTCCTCTGTTTGAGGAGCGGATCCAGTTTTTCTTGAGCCTGCAGAACGAGATTTCCGAGTCGAAGCA
CTCCAAAGACGTCGGGTTTGTGCGCGTCAACTCGCTGCCGATCAAGCAGGCGCTATCGACGTGGGTCACCAAATGGGTCTATATGTTCACTCAGTACCTG
CACGACCGCGTCGTAAACCAGCTCATTTGGCTCGACGACTTTATGCACGCGGTCAACGGCGGACTCGACCAAGAAGTCGAGACAGACAACTTAGAGCACG
GCAAGCTGACGCTCATGACGTGCATGCATCACATCCGCAATGTCCGGCGGCTCATGCGGGAAGATCTTCTTGTGCGGTTTGACCCGCTCAAGGCCATCGT
GGTGCTGCTCAAGCAGAATGGCATCTCTCTCGAGCAGTCGTACGTCGGGAAGGAAAACGTGCTCGGGTTTTTGGACCAGGCGCCAATGAGGTGGGAGAAC
ATGGTCAACAAGACGTTCAAGAAGAAAGAGGCGATCCAGCCGCTGCAGAACCTCATGGTCGAGTCCATTCGCACAGAGACAGCCGAGTTTACGCGCCGCC
TCCAGTTTTTGCGAGAAGACTTCACAGCCACTGCTCCGCTTCATGCACCGATACAGCGCACGTCGATTGCCGAAGCTTACGAGTTGCTGGATGCCTACCA
CCTCAAACTCGATAAGGTCGAACAAGAAGCGGATAGACTACTCGAACTGGAGGATATGTTTGAGTTAGTTTCTAGCAAGAACGACCTACTGGTTGTCTTA
AGAGCCGATTTTATCCTGCTCAAGCACGTGTGGGACTTTGTAGCGCTTTTGGACGACATTTACGTGCACAAGTGGCAGCTGCTGGCATGGGACGAGCTCA
ACACGGACGAATTGATGGAGGAGCTGGACGAGATCGAGCGTCGTCGCATTGCGGTGTTCCCGTCGACTCGAGCCGTGAAGGAATGGGCAGTGTACCAGCA
CCTCACGCAAAAATTCCAGCAAATGGCTGTCATCCTGCCGCTGGTCAAGAATCTCCACTCGCCCGTCGTACGGGATCGTCATTGGAAGAACTTGATGGTG
CTAACGCGGAAACACTTCGACCTCACTTCGAATGTCCACACTGACTCGAGTCTGAAATCTGGCACGCCTCGGTCAGGTTCAGGCCCTGCAAGTTCGCTCA
GGTTTGAGGATGTGCTTCGCCTAGAGCTCTTTCGGTTCGTGAACGAAGTCAACGATTTGGTGGAGATGGCCGCGCGGGAGTTCAAAATCGAACAGCAGCT
GGACGCCATCGAGAACATGTGGAACTCCTTCCAGCTTGATTTCGTGCCGTATCGAACTGCAGGGTTCAAGGCAGCTCAAGCTACTCAGCCGACGAAGGCA
AAGCCTAAACTGGATCGCCTGGCGTCCTCGTCCTCGATGAAGAGCATTGGCAGTACTCTCGATTTGTCTCCGGACAAGGCTGATTCTTCGCCTCAGGGAG
GAGAGGGCGATTTGATGATTTTGAAAATGCCCAACGCGATCATCGAGGCGCTCGAAGAGCACCAGCTCCAATTGCAAACAATGGCAAGTGCAGGTAAATT
CGTGGTGTATTTCAAGGACAAGGTGTTCGAGTGGCAGCTACGGCTGGGCAACGTCGACTCGATCTTGAAGCTGTGGATCTCGCTTCAGCGCCAGTGGTGC
AGTCTCGAGTCGATCTTTCTCAGCACAACTGGCGACATCCAGCGTCAGCTGCCGTCCGAGTATCAGCGTTTCCAGCGCGTAGATGAAGAAATCAAGGAGC
TGTTCGCCGATGCGCAGCTGTTTCCGACAGTTCTCGTTGCTTGTTGTCAACGAGAAGGGCGAGAGCAAGTGCTGAGGGATCTTCAAGGCGAGTTGGAGAT
TTGCCAGAAGGCTTTGAACCAGTACTTGGACGGGAAGAAAGACATCTTCCCACGGTTCTACTTTGTCTCGAATGCGTCGCTACTGGAGATTCTGTCGAAC
GGAAACTCTCCTCCGCGGCTACAGCCGCATTTCGGCAACTGTTTCGACGGTATCGAAGCATTTGATTTCGAAAACGCGCACTCAAGTTCAGAGGTTGCTC
GGCCACCTGCAGCCGGAAAGGGATCCCAATTATCGAGCTCGGCCTCCTCGACCAAGATTACGGAGCAGTATCTGGCAACGGCCATGCGCTCGAAAGAGGG
CGAGCTCGTGCGCTTTCCGGACTCGCACTTGGTGCATGGGAGTGTGGAAAACTGGTTCAACGACCTGGTCGTCGTCATGCAGGAGACCCTGCGACAGGGC
ATCTTTGATGCAATCGAGCGGAGCGCCTTGTGGGGTGTCGACTGCGCGCGGCACACATGGGTCTTCGACTTTCCTGCCCAAGTGGCGCTACTCGCGAGCC
AGGTTGTCTGGACAGAGGAGGTCGAGAGCGCACTGGAAGAACAGGAGAACGGCACGGAAGACGCGTTGAAAAAGTACTGGGATGTGTCGACTGTGCGACT
CGAAGAGCTGATTCGACTGGTGCAAGGCTCATTGTCATCGCTGGATCGCCAGAAAATCATCACGCTCATCACTATTGACGTTCACGCTCGCGATGTGGTG
CAGTCGCTGATGACCAAGAAAGTCAACAGCTCGCTAGACTTCCAATGGCAGTCGCAGCTTCGCTACTACTTGACGCCCGTGGTGACAGGTGGTCCACCGA
AGAAGGAAGTCTATATCAAAATCTGCGACTTCCGGTCCTTCTACCGCTACGAATACATTGGGAACTGTGGTCGCCTAGTCATCACACCGCTCACGGACCG
GTGCTACGTGACCCTCACGACTGCACTGCGTCTGTGTCTTGGTGGCGCGCCGGCGGGGCCAGCTGGCACAGGTAAAACGGAAACTACCAAGGATCTTGCG
CGTGGGATGGGGCTGCAGTGTTACGTGTTCAATTGCAGCGATCAGATGAACTACAAGACCATGGCTGACATCTTCCGAGGGCTTGCACAGACCGGCGCTT
GGGGATGCTTTGACGAGTTCAACCGCATCTCAGTCGAGGTGCTCTCGGTAGTGGCGACCCAAGTCAAGACTGTGTTGGATGGACTGATTTCGATATTGGC
GACCACGGCACGGGCTACAACTAGTGGTGGGGGCTCTGGCGATGCGGTGTCATCGGGTGGCCACGATTCGACTGGAGTGCAGCCAGTTGCAGTCCCGCCA
GTGGGCAATTGCGACTTCTTCGGCAAAACCATTGCTCTCGTGCCGACTGTCGGGTTGTTCATCACGATGAACCCTGGGTATGCCGGTCGAGCCGAACTGC
CAGAGAATTTGAAGGCGCTGTTTCGCTCGTGCGCCATGATCAAGCCGGATCTGCAACCCATTTGTGAGAATATGCTGATGGCCGAAGGATTCCTGAAGGC
TCGCGTGCTGTCCGTCAAGTTTGTCACGTTGTATAACCTGAGTAGCGAGCTGCTGTCCAAGCAGAAGCACTACGATTGGGGACTGCGAGCTGTCAAGTCG
GTTCTCCTCGTCGCGGGCGGTTTGCGCAGAGCTCAGGCCACCGTTGCAGAAGAAGCCGTGCTTATGCAGGTGCTCCGAGACTTCAACACTCCGCGGATCC
TGCCTGCAGACTACCCAGTCTTCCTGGGCTTGCTCAACGATCTTTTCCCGGGTTTGCAACTCTCCCAAATGAAGAACGAGACACTCCGCTCCAAGTGCGC
CGAAGTTTGCTCAGCTCGGAAGCTCCAAGCGGAGGAAGGGTTCCTCAAGAAGATCATGGAGTATGAGGAAGTGCTCAAGGTTCGTCATAGCGTCATGCTG
ATCGGACCAGCTGGATGCGGCAAGAGCACGATCTGGACAACGCTGGCTGCATGCCACAACTACTCCATCGAGCACGGTGAATCGTCCAAGCCACTGACAG
TGTTTGAGACGCTGAATCCGAAGTCGATCACCGCGGACGAGTTGTATGGCTACATGACGCTCGAGAATGATTGGAGAGATGGTGTCTTGTCGTCCATCAT
GCGCAACATGGCCAAGGACGTATCT