Description :
From Genome Similarity Track
Location :
Scaffold_1451:5821- 8176
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1451-fgenesh-gene-0.1Cryptic tubulin

Sequence
2355 bases(100 bases per row)
ACGCGCAGATCCGACCTCTCCGAGTTCGTTCTGCTGCCGAGGAAAAGGCCTCGTCCGCGAAAGCCGATCGAGCTGATCCTTGAGACGGACGTGTACACAG
CGGGTACCATCGAAGAAGTGGAGAACCAAACCAGCGATGAGCGTTATCGTACGGTGGAGACTGTAAATCGACAGTACGGCTTTCATTTTCCGCTCGCTCC
CACCCCAATTTTGGGCGAGAGTAGCTTTTCACATAAACCAGCTCAAGACGGCCAAGGCGGTATCAATCGCGATCACTTCATGTGTGCTGAACCCGCAGCT
CCAGTCACTGGAATTGTTGTCGTCGAAGAAGGCGAATCCACGATCGACGAGCTGGAGCAACGCCTTCTCCATTGGCAAACACACCGTGAGCGGCTCAAGC
AGTTGCAACACTCGCTTCAGGATTTTCGACAGCTTCTCCACCAGGCTTCAATGGAAGGGTACGCACTCGCCAGCGGATGTCAACTCTACCAATAATCGGT
CTTTGACGATTTGTTTGTATTGTTTGCAGGAATCTCACGCCGCACGAACTCGAGTTTATGCGGTCACGCGTGCGTACTATGGAGCAGCAAGAAGCCACGT
CGCGACGTCGCTGGCACGAGTCACGCCCCGAGATCCTCTCGCTCGCAAAGCGTATCAAACATCTTCGTGGTGCCATGACCGCCTCGGCTTAAATCTTGCG
TGGAGCATCTCGTCATAGCTTTGGATAATCTTGGTGCTCTGCTCCAAGGCGTTTTCAAAGTCGGTGTCCTCAAGTCCGTACTGCTTGTACCAGTGCGTGT
ACGCGCGTGCCTCGAACTGCCGTCGCCCACGGTCGATAAAGTGGTTGATACTCGGGGTAGCGTGACCGTTGTTGAGTGTGACGGTCACGGACGCCCTGCC
GCTGCACGACTGGAACGGCGCGAAGAGCGAGTGCTGGATAGGGACGCGAGTGTCGAGGTGGTACTGTGGAAGATCAGAGTCCAAGGCCTTAATGAAGAAA
TCAGTGCCGCTCACTTTGTGTGGCCCAAGAGATGCGAAACGGACGACGGTGCTGGCCGTGATCGCTCGGCCCCCACTTGCTGATCGAGGGAACGCTTGCA
TCGTCCGGCGCAGGAGCTTGACCATGGACATTTCGACGTCGTCTCCGCCAGTGGGCGATGTCGTTGGCACCGCGTGGAAAAGAGGGTCACCGCTTCCAAC
ACTGACTTTTTTCGAGCTGACATTGCGTGAGACACCAGTCCGCGTGTCCAAGAACTTGACGGTTGACACTGGACAGCAGTCGTGCACAAGGTTCGCCATA
TCAAAAGGCTGAGCGACAAGCCCTCGCTCGCCGTGCTTCCTCACCATCGGGAAGACCAGCCCGGCAACGTCAGTCGCTACCAGCGCATTCATCTCTCGCA
GCGAGACCTTTGGCGTGCTGCCGTCCGCATCTCTCGGTGCCACGAGGGACTTCCAGTACCACGCCGTTCTCATGAGCTCGTCGTTGTCTTTGTAGACCAC
CCAGTCGGTGTGCTCTTGGAGATGCTGCAGCGTGAAGAGCGCGTTGTAGTTTTGCAGCGGCGTGTCGCCGCTCGCCAACNNNNNNNNNNNNNNNNNNNNG
GTGCGACCGAGACGGCGCCAAGGTAGCTCTGCGGGTACGTGTCTCGAATGGTTTCGAGCAGGCGACAGCCGAGCCCCGCGCCCGTGCCACCACCCAGGGA
ATGCATGAGCATCGTGCCGCGGTACGCGTCCACGGCCTCAATCTCACGCCGGAGTGACTCCATCACGAGCTCGACGAGTTCTCGCTTGCTTTCTGTCGCG
GCTGCTGCCAAACGCAGTTTGTGCTTGGCTGTTCGTGTCGTAGCCACACCAACGAGCGAGGCAGTGTCACTCTTGGACGGCAGGACGTTGCGCTGGTGGG
TCTGCAGGTTGTAGCCCATTGCCCAGTTGTTGCCGCGCCCAGACTGCTCGTAGTGGATGTGAGCCGGCTCGAGCCGCCAACCTGCTGCATCGTATTGATT
TCTCAACATGGAGCGGATCACTTTAGGTTCCGTGTCGACGAGAATGCAGCGCGCGCGGCGTGACGCGCGGTGGAACAGGCAGTCGGTGTACAGCATGGGC
AGCGGCGGCGTTCCAGTGCGAGCGGACTTGAGGACGCTCTTCTTTGTGAGAGGTGGCGCTATTGGTGTGTGAGCGGTGGTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGAGCCGCCAGAACGCGTTGCCGAGCTGGTTCCCGCATTGCCCGACATGGATGACGGCGCTCATTGAGAAGCAGAGACTTTTCAGGAG
GCAGCCAACGGGTTCCCCCGGGGGTACTATTAGCTTTATGGTGCAGATCGGAGAA