Description :
From Genome Similarity Track
Location :
Scaffold_1280:5820- 9083
Sequence
3263 bases(100 bases per row)
CTCGGAGATCGCGTAACAGCTCACTTCTCTAATGGAAAAACACAGTAGCGTCCTCTTCCGCTTCGTCAATCTCAATCCGCATACACTGAACCAGATATTG
TTGAAGTCGAGACACAGGATCCGCCACAAAAGTCACTGGCTGAGAGTTAAATAAACGACCTAACTCACACTGAGCACTCTAAAAGCTGCCACCTCCGCCA
GTAACTTGGGCGAGACACCCATTCACTTCAAGATTCGTCACCGGTAGACTACTGCTGGTCATTACGACCTCAGGCTCAGAGTCTTCTCCGGTATCAGGCA
AAAGTTCGTCGGCGGTGTCGTCACAGTCCTTTTCTACCAGAGTTGGCAACCCAGTAGCCAGCTGAGGTGGGAATGGCGCATGCACCATCACGCTACCGAG
TTGGCTGGTACCAGTGCACGCGGGAACGACGTACCCACCCACGGACCCGTTGCTGAGACGGTTGTAGCTCTTCACGAGAACAACGTTTCCTCCGGCAAGA
TTGCGGGGTACATGAGTGGAAAAACGGGTAAGGCGACTTCTTGCTATTTTTAAGTGAGCTGATTGTTGGTTGAAGAAATTATTCTAATGTACTTGACTTT
TTTGATACCGTAAGGTCGTCCAGTCAGCTCTCAACTTGTTCGCAATTTGATCAGAAAACGGCAAGGTGGAGGCAGCGCACAGTCTCGCCTCAAGCTACGC
CTCGCTGCCTGGCAGCACATGACGGGAGTGATGTGGTGGTTATTCAGGACCAAATGGATGTCACCTGTGCGATCGTCGTGCAGACCGCTGTTCAGAAGGT
TGCATTCGAGCAGTGGGGAGAGTCACTCACCTTAGACTGGACGCACGGAGCCAACAACGTTGGATATCCTCTTGGTAAGGCTGCAAAAGGTTTAGCGACG
TTATGTAAAGACTGCTTGATGCTAACCGCTCTGTTTTTACTTATACAAAGGGAGTCTTGTGGCAACAACGCCAAGTGGTCGTGGCTTTCCTGTTCTGGAC
TTTATGTCATTGAACGAGAAAGCGGTCACGCTAGAGAAAATATTTGAGTTTTTCAAGACCACAAATAAGTCGTGGATGAAAATTCAGACGTTCGTCATCG
ACAAGCATTTCGTCGAGTGGAGCGTCTTCGTAAAGTGTTTTCCATCCACCAAGGTGTTGCTGTGCCAGTTCCACGCAATCATGTactggaagaagctggt
AGGGAGTCGGTTCAAGTTGAGAATTGCAGACCAAGATACCGTCCAGTGCTTCTTTGCAATGATGTTGTATAGGCAACGTGCGACGTTATCATTCACGGAC
AACGTTAACGTACTGACGTGGGTTTGTGTGCTTTGTTATTAGTAACACATCGGCATCTTTTGACCGAACGTACAATGACTTTTCTTCTTTCTGTGAAGGA
AGTCACAAAGCCGCTCGCCAATACTTTGACAAGAACTGGAAGGACCACCGTGACATGTGGTCTAATTATTTGCGGAATAAGGTGTTCACTGCCGGAAACA
CCACAACGAATCAAATTGAATCAAATTGGCACTTGCTGAAACAACTCCTCGGGAAGAAGACTGCAGTTGATCAAGCTGTTGCTAGTGTTCTCAAACACCA
AGGCACCACCTCGCGCCAATTTTTACAGTCCCTTCATAGACACAACTGCAGGTCGCGCAATCTGGACACTGTTCCTGTCTTCTTgcggcgagctgccgcg
TTGATGAGTGACTATGTATTGGCTAAGGTTCGCAGTCAGTGGGATTTGTTCATGGTTTCAATGAAAGGCGTTTCATGTGAGAAACGAAACGATAAGCTTT
CGACATGTGATGTTTTCGTGGGAAGCAATACGTACTCATGCAGCGATATTGAGTGGACGTGTACGTGCTTGTTTGCGACGAGCCAAGGACTACCGTGCCA
ACACGTGATGTTCGTTTGTCGATATGGGCATGGATTCGAAGAATTGCCAAGGATGACAATtccttctcgctggagcaTGGCTGAGGCATCTAAAACTTAC
GGACAGATTGAAGAGGGGGCATCATCAATTGACTCAGTTATCAGCTTGATCAGGCTGAAGATTGCGGCTCGTTCATGCACAGAGTCTTGTGCAACGTTGG
CCGATCAATCCGACGGTACCACCATCAAACTCGAACAGCGTTCAAAAACTCGCGTTGCTTATGTGCGGCTTCGTCGACAAGAAAACGGAAATGTGGTTAT
ACTGTCGGTTGAGGAGAAATACACGTTTGCAAAGACGGTGTTCGAGCCGGTGTTGAATCACCTGCAAAGTATTTCTAGCGTAAAGTTCTGCAAGGCCTTG
GCGAATTGGGAATCAATAGTAGCAAATGCTATGGAGGCTACTCAGTCTGTTTCTAGCAGAAATAAAGAAGCCACCGGCTCGAGTGAGGAGGTCTACGAAA
TGGACCCAACCAATTGTACTGATGTGCTAGAGCTGATGAGAGAAATGGAGCAGAGGTATGATAGCTTGGATGAAGAGGACCAAATTGATGCAGCAACGTT
GTCGGTCTCAGCAACGTTAGTGGCAGGGGCAACGTCaacaacgccagcagcaaaatACAACTCAGTAAGCAAAGCGAGTATAGCTGAACCTGCTGGCGAA
TGCTCGGAAGTGACTGCGGCGGAGATGCCGTTGTCCGCATTTGCACCTCCCACGTATTCTGCCTATGAAGAGACAACTCTGTCGCAAAATTCGTTAGGGA
TTTTGATATCTCCGAAACGTCGCAACGAATCATTGCAGAAGCAGGAGTAGAAGCTGTTAATGCTGCTGATATCGGACAAAACGACACAACGCGTATTCAA
TTAGTCACAAGTACCGGACCTGACGGAAACAAGAGCGGTGTGGAGCTAAATCTGCAGCGTCCCGTACGAGGGAATCCCAGGAAGAAGCTAAGACAGAATT
GGGCGTCAGTCGCCGCAGTACCTCGGTATATTGCGGTTGAATATCCCAAGGGATTAACGGCCACAGTTAGCGACGTCAATACGTGGGCACTCAACACGTC
CCGACTGAAAGATGCTATCGACATTTTGACAAGTACCCGTGCATCATGAATGAGCAAACGTTGCGTAGACGGTCTAGGCGCGTACGAGAGGTTACACGAC
AACGGGCAGCTTCCTACTGCTACAGCTACGTCATTCCGGAAGACTTGGTGATCTCGCTACAAGCAGCACTTGACTATTTCAGGAGTAGACATGAAGCTGA
ACGCAAGGCCATCCATGGGGAACCAGGTGTGGTGCCACACACTGTCGAGGTTCCGTAGATGAC