Description :
From Genome Similarity Track
Location :
Scaffold_775:582- 2661
Sequence
2079 bases(100 bases per row)
TATTACCACGATGGTGGCGAGTTGTTCGCTGAGGATGTAGACCAGCATATAGAAGTTCTACCCGAAGTTATTACACCCGCGCAAGAAATAACAATTGATG
ATATCCAAGTAGGCGATCGAGGCGTCCGAAGGACTGATGATCAAGGTAAGTTGCGACAAGTGATTTAGAGAAGTCGCTTTTGGCTGATTGGAAAATGTAA
TGCCCAACCATCTGCGGCGCGTGGGGAATTTACGAAATAGATGCGGGTGGGGCCAACCCGGTCGCGCAAAGGGTCAGGCCTGTAGCTTCCAATTTTTTGA
GAGAAACACGCCAATCCGATTAAAGGGTTACTGCCGGCCAAGATCATCCGACCATCTACATCACCACGGGTGGCTCCTATAGTGGTGATCATCAAGGCAA
ACGGAGAAGACATAAGGCTGTGTATTGATTACAGTCGGGTGAACTAGCTGACTAGGTTGATGGTGTATTCGATGCCTCTGATCAGTGAGCTATTGTAGGA
CATGGACAAAGCCATGTGGTGCTGTTCCCTGGACATGGCGAGTGGTTGTTGGATGGAAATGCCTTAAAGAGCAATAGCTATTTCCGCCTTTATCACACCA
TCAGGGTTGTTTGAGTGGTTACGGATGCCTTTCAAGTTAAAAAACGCTCCACAGATTTACGAACGGTTGATCGACAAAGCTCTGTACGAATATCTAAAAA
TTGGTGCAATATCCGAATCGATCACGGCCGGGTCACCGAAGTTGATCGATTCCTTCACCGATGGTGAACCAGATACTGATCCGAAACCATCCGTGTTGCA
TCGAAGATCCTATATCGACGACATATTGATACCAGCTACGTCGTGGAAATTCCTGTGTGAACAAGTGGGAGGTTATTGAAGGCGTGCGATAAGTGGAATT
TGTGGATCAGTTTGGCCAAACGTTTCTGGGGACGTCGCAAGGCGGAATACCTAGGACATCAAATCTTGCTCGCAGGTTTGGAAGCTAATCCGAAAAGATT
TGGGATAATTGGTGAACATCCGGCTTCCTCGGACGCTGCGATCGATGCAGTCATTTTTGGGAAGTCTTAACTACTACAGTCGAATTATTGAAGATTTCGC
AATTTACGCATCAGTGTTGTACGAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN