Description :
From Genome Similarity Track
Location :
Scaffold_1:5819714- 5830178
Transcript NameFunction/comments
Physo_553640lysosomal beta glucosidase, putative
Physo_355162Hypothetical protein
Physo_553644cysteine protease family C01A, putative

Sequence
10464 bases(100 bases per row)
CAATGAGAGACAGCATTTCAAAGACAGGCACGTTGGCGCTGGCCTGGACGCTGCTGGGCTGGGCGTGCAGTGGCGCATCGGAGGCTGTTCTCGCGGCTGC
TACGGCTCCTGCTCGCCATGAACTCGTGTACGACCCCGACACCGCCGTGTTCGCCGACCTCAGGAGCCCGGTAGAGGCCCCAAACGACTCTAATGGCGCG
GATGTCGACGCCCTGCTGACCAACATGACGATCCGCCAGAAGGTGGCGCAAATGACGCAGATGGATATCTATTCCATGATGGACGGGGACGAGCGAGACC
CGAAGAAGGCTCTGAGACGCGAGGTGGTGGCTCGGTATGCTCGCGCGGGTGTGGGCTCCATCCTCAACAGCCCATTCGCAGGGGGTCCCGTCGGCGGACG
CACTGGGTGGAGCGCCAGCGAGTGGAGATCGGTGATACAACAGATCCACCAGATCTACAAGGAAGAGGGGGCTACGGTGCCCATGCTTTACGGGGTGGAC
ACCATCCATGGCGCCACGTACGTGCAGGGGGCGACACTGTTCGGCCAGCCCATCAGTGCTGCCGCCTCGTTCAACCCCGAGCTGGTGTACCGCATGGGTG
CTGTGGCTGCGAAAGACACGCTGAGTGCAGGCATCCCGTGGATCTTTAGCCCTGTTTTGGGTATTGCAGTGCAGCCAAAGTGGTCGCGCGTGTACGAGAC
GTTTGGGGAAGACCCACTGGTATCATCCGTCATGGGGGCGGCACTTATCAAAGGCCTGCAGAGTTCGGGCAAGGTGGCGGCTTGCATGAAGCACTTTATT
GGCTACTCAAATGTCCGCGAGGGATTGGATCGCGCGGACAACGTCATTAGTGACTGGGAGCTTGTCAATTACTACGCTCCGCCGTTCCTTGCTGCAGTCC
AAGCTGGTGTACGCACCGCTATGGAGAGCTACGTGTCGGTGAACGGAGTCCCTGTGATCGCCAGCAAAAAGCTACTGGTTGACTTGCTGCGACACGATAT
GAATTTCACAGGTCTGTTGGTGTCGGACTACAGCGAGGTTGATCGCATGTACTCGGAGCACCATTTAGTGCCGAGTGTGGCGGATGCCGTTCGTGTTACT
TTGCAAAAGACGTCTCTCGACATGAACATGTCACCGGACTTGCAGGCTTTTGGAGATACGATCGAGTCGCTGGTTGCGCAGGGGCTAATTACTGAGAGCC
GCCTCGACGACTCTGTCCGACGCATTCTGGAGACCAAGCGAGACCTCGGGCTGCTTGACTCGAACTACTATGAAGACTTCAGCCAGGACGATACGGATGC
TGACGAAGATGTCGGCAGCTCAGCCGACCAGCAGGACGCTCTGAAGCTAGCGCAGGAGTCCGTGATCTTGCTTGAGAATCGCAATGGTGCACTACCTATT
GACCTGGACAAGACTACCAGCGTGTTTGTCACCGGCCCGGCCTCGGACAACAAAGGCTTTCAATGCGGTGGGTGGTCCGTCTTCTGGCAAGGATCCGGCG
ACTCGACCCTTTTCCCGAACGGTGCCACTTTCAAGGAAGCCGTCCATGGGCATGCGCAGGTTGAGCACCTTGAGGTGGTGGACATAGATGGCAATGTGAA
CCCCCAAGACTTCCAGCGCGGGATGCAGCTTGCTGCCAAGAGCGACTACACTCTGGTCGTACTGGGCGAGCGCAACTACGCCGAGAAAACTGGCGACTTG
CTTGGCAGTATGGCGCTACCCGCTGGGCAGTTGTGGTATCTCGAAGAGCTCACAAGGCTCAACTCTACGAAGGTGATTGTCGTGCTGATCTCAGGTCGTC
CTCGTTTGCTGGAGGGGGCCCACGACCACGCCGACGCTGTCATCTTGAGCATGTTACCTTGCGAGCAAGGTGGCCAAGCCCTCGCCGACGTGATTTTCGG
CGAGGTGAACCCGTCCGCGCGGTTGCCCATTACCTATCCAGCTCGCGGCACGCAGCTACTGCCGTACTTCCACCGGGTGAACACGCGATGCCAGCCGTAC
GACGAGTGTCCGGTGCAGTGGGAGTTCGGCCACGGTCTCAGCTACAGCAAGTTTGAGTATTCGGCGCTTCGGCTCAACGCGACGCAGGTGCACGCCACAT
CGGGCGCGTTGGAGGTCATCGTCACGGTGACGAACCTCGGCTCTCGCCCGGGCAAGGAGGTCGTGCTGCTGTTTGTTGCGCAGAAGTTCCGTCGGGCGTC
GGTGCCCGAGACGAAGCTGCTCAAGGCGTTCAAGAAGCTGGAGACGCTGGCGTCCGGGGCCAGCCAGGACGTCACGTTCGTGCTCACGCCCGAGCACTGG
AGCTACTACGAGCCGCACGTCGTGGGAAGCGGCTTTCAGCGGCGCGCCGAGCCCGGCGAGTTCGTCGTCTCGCTGCTGCCCTCGTCCACGGACAGCTCAA
CGCAGCCGCGGGCGATACCCTCCCCAGACGACGCTGAAAGATCCAGCCAGACGAAGACTCGCGGCGCGCCGGGCGGCATAGCCTCGGACTCGGAGGCGCC
GGGCCCGGCAACGGCGCCACCAAGCGTTTCGTTCTATGTGGTACCATAGTGAGCGTAGCGCGAATCGGCGCTGGTGGCTGGTTTCGCATAAGTGGTTTCT
TGCGTGGCATTTCAGACGCGGCGGCGGCCGGCCTCGTGGCCGCTTTGGCTCGAGCACGGACGTGCGCCTCGCCTCAGGGCCGCAGCCTGCAGCAGAAGCG
CCGCAGCGATGGATGACTCTGCTTTTAGAGGCCTGAAGCTACCGGGCTCTTCTCGTCATTTACAATAAGAAATGTGTGTGCACAGCCCGCGTCTTTGCCG
CTCCGGTATTCCGCCGCTATAAATGCTGCTGCGGGGCTTGGCCTCGACATGGGGCTGGCGGCCGCGATAAGATCGCGCCGTTGGGCCGCTGCGGACCCAT
TATTGCCGCAACGGCCGCAGTGACCCAAAGCCAGCTCCTCCCACTCTCCCGCTCCGAGCCCATACACAGTCATAGAACAATCTGCTTTTAGCCACGCACC
GCGCACTCACTCACGGTAACAGATCGCCTCTGAGCGCGGGCAGAGATCTCAACGCCTTGACAACGCCGAGCTGGCCAGTGACCTCCTCCGTCCAGCAGCC
CCGCCCGGACACACGCGCGCTCTCTTTAAGTCGGCTATCGAGCAGCGCCGTCGCCAAACGACAGCGCGGGCAGGCAGAAAACAGAAAGAAACGAACCTGC
GAGGAAAGGCGCGGCAAGCCCGCTGGAATCGCGGCGGAAGGCACGGCATTAAGCGATCTCCGTGGCGCCAGGAACTAACGACCCGCGGCGAATAAGACAA
TCACAGGCAGGCAGGCCGGCCGTGCGCAAGGGATCACTCTCACTTGTCAATTGGCCACGAGCGCGCTGTCCGCCGATCACCACTCCGCCGTCTGCTACGT
CGCTGCTGGCATGACGCAACGCGAGCTGTCCTCGCTCATGGCGGGCGCTGCCGGCTACACGGAAGCACAATTGGTGGTGCTCGTGCTGAGCGTCGTGGTG
GTGGCCGTGGCTCTGCTGTCCTACTTTGTGGTGGCGCCCGAGTACGAGAAGCACCTCGACAAGCAGTACGCGGCGCTCGTGCACGCCTCCTCGGAGCGGC
AGCTGCACAACCAACAGGCGCACGAGCTGCTGCTCGCACGCATCAAGCTGCGCAAGCACAAGTCGCTCGGCGCCTGGGACATCGAGTCCGGCTCCAGCGA
CGACGACGGGTTCGGGCACTGCTCATTGCAGCGACGCCACTCGCACATGCGGCCGCCCCCGGCCAGCATCTCGTCGCCGCGCGACATGATCATCGAGGCG
GCGCAGGTCGCGCGTAGGGAGCGCAACGCCCGGCGCCGCAAGAGCGAGAGCGACGCGCTCAAGCAAGCCAACATCCAGCGAGCAGACATGCTGCGTCGCC
GAGTCCTGCTGCGGAAGCTAGAGGAGGAGATCGCTGGCACCGTCAAGGCGAACGAAGAGGCCCAAGCCGCCGAGACCAGCAAGAACCCGACCCTGGCGAC
TGTACGACGACTCTCGAACAACACGCTCGACCTGAGCGACGACCGCCTCAAAATGCTTCAGGAGCACCCAGCTGATTGCGTTGAAGAGCTGAAAGTGCTC
GCCCAAGCGCAGTCGCCTGCAGCCTCGTCACCTCTGGTCGACAACTCAGCGATGGCCAAGGGCAAGGTCGACAGCCCACCGGACCTCCTCGAAGTAAAGC
GTGCCTTGAACGTGCTGCACGACGTGCTGAGCTTCTACTTGTCGGTGGACCACCGCGACATGAACAAGCTCACGGTGTTCTGCAACTCGCTGCTGCAGCA
CGACGGTCTCAACCGACTGCGAGCGTTCGAGGCCTCACGCGACCAGGACGTGCGAGCGCTGTCGAACTCCATCATCGAGAAGGCTGTGCCCGCCATTTGG
CACTAAGGACGGGACGCGCTTCCTTCGTCTATTATCTATGAACGCCCGTTTTCGCCGACGCTGTAGAGCTCAAAGTAGCAGTAAGTAAGTAAGTAAGTAA
ATAGCTCCGTCGGTAAGCTAGCACGCCTAAACATCAATAACTATCCCCCCATGTGTCGATGCGGTGTTCAAAATTCATACTTGTCATTGTCATTAGCGTC
CGCCGCCGCCTACTTCTGCTGGAAAGACGCCGCAATCTCCTGCAACGATCGCGACATCACCGCACGAAGCACCATGCGCGAGATAGACCCGCCACAGAGC
AGCACTCTGCCGGCGGCGGAAGGCGTGAGCTTGGAGTTCCACAGGATCAGCGTCTTGGGCTGCGCGGGGGCGACCACCGTGCTGTCCGCCAGGAACTGCA
CGAAGCCGACGTGGTCGCTCAGCAGCAGCGGGCCGCTCTTCTTGATGCTGTAGCGCACGCTTGGGATCCGGTCAGAGCCATCAGGTGGGCCCGCTGACAC
GATCTGCTCTTCGACGCCGAGCGAGACGAGCCGGCGGTGACCCACGAGGCCGCGGCCCTCGCCGGGCTTGAGCGTCGAGCCGCGGTCCACCCACTCCATG
CGCATCCACGCGTCGTACGCCTCGTCCACCGACGCGTTCACCAGCTGCGAGAGCGCCAGCTCCTGGCCGTCGTTCTCCTCGTAGGCCTCGAAGCCGGCGG
CATCGACGTAGCGGTCCATGGCCTGGTGGAGGGAATTAGGAAGTGAATGCTGTGGTTGGATGTTAATCTGCAAGTTGAAGCAACAATATATTGACGAATG
AAATGGCGTCATGATACTCATTTTGTCCAATCGTAGAAGGACGCCACTCAGAAGAGCAATGCTGAAGGGCGAGTGGACTCACTTGTATTTCCAGCCGGGA
TGGCGCTCTAGCTTTTACGAAGATAGTTCTCGCTACCTATTCCAGATGTCTGTGGGCCTTCGCAGCGGCGCTTGCGGCCAGAGTACTCAAGAAACCCTGC
AGCGCCGAACGCAGGACGGCCTTGACCAACCCGCCGCAGCAAAGCAGGTATCCCAGTGTCGTGGGCTCCGTCTTGAGCGACCAGATCACTAGCGTTGCCG
GCGTGCTCTCAGGCGACGCCGCCACGTCGACGAACTGCACGAAGGCGAGGTGGTTCTGCAGCGGGAGCAGCCCGAAGTTGCGGATCTTGTAGCAGATCGA
CGGGATCTTGGAGCGGTCTCGACGGGCAGCAGCCAGACTGGGTCGACCGCCGTCGCTGTCCACTTCCTCGTCAACGGGCAGTCCGACTGAGAGAATCTCT
TCCTGGATGACTAGCGGGGCCAGTCGCACGTGACCCACGTAGCCCCGACCTACGCCCTCGTGGAGCTCTGAGCCTCCGGCCAGCCAGATTTCCTCCAGCC
ACGCGTCGAAGACCTCGGACGGAGACCCAACAACGCACTCGGACACCACCAGCTCCTGGCCTTTGTGGCTCTGGTATTCCTCAAAGGCCTGCACGTCCGC
GTAGCGAGTGGGGTCCAGGTGACTTCTGCGGCGCATTCTTCAGCTCAACTTGACACACGAGAACTTATTTTTCTCCTGATATTTAGCCAATAACATTGCG
TAGATGGGGCCAATGGAGCCCGACGCCGCGACCGAGACGGCCAGCGTGGGCGGCGCGAAGCTCTCGAGGCCATGCAGCGAGACCAAGTTACCTTTTGGCC
GCCTCCTTAGCTAGCGACCGTAAGAACGTTTTTAGCGCTATGCGGAAGATCACACGAACGAGCCCGCCGCAGTGCAGCCAGTTGCACGCCCTCGACATCT
CCGTCTTCACCGTCCAGATCACGAGGGTCTTCGGCGTCCTGTCCGCCACATCACTTGCGTCGACGAAGCGCACCATGGCGAGGTGGCTTTCAAGAGGAAA
CGGACCAGGCTTGCGTACTCGATAGCAGATTGACGGGATCTTGGTATTGCAATCTTCCTGTCCTTGTGCTGGTTCCTCTGGCAGCCCTGCCGATACAACT
TCCTCCTCCACGCCGAGGGGGACACGTCGTACGCTACCGACGTATCCGCGACCGGCGCCTTCGTGCACTTGATCCCCACCGGCAAGCCAGACATCGCGAA
TCCATGCATCGAAAACCGCGGAGGGTGAGCCCTTCACCAACTCAGACACCTCGAATTCCTGGCCAGCGTGACGCTCGTAGGCCTCTACAGCTTGAACGTC
GACGTAGCGTTCATCCTGGATGCGTGCTGCGGACTTCATTTGGCCGTCACTTCAATCGCTCTATCGATGATGAACTCGACGAGCTCCGAAAGATGAATAT
TGAGATTTGCACAGTCGACTGAGTGAAATTGACAGTACACTATGAAACTTGATGTTGGCTACTTCAAAGTCCTTGCCATCAACTCGATCGAGCTTACTGT
ATTTCATTAGAAACTTACAACTTCATCTTGGCATCGGCGGGATTCAAATAATTTACAGCATCTCCTTGAAGGCATTGCGTTGGCGGCTGGCGTAGATGAC
ACCAATGACGGTGAAGAAGACGGTGGCAACAGCGACAGCGATGCCTAGGATGATCCAGTTATCCGGCGACAGTCCGACAAATTCGACAGCACCACCGCCA
TCGACCACTGTGTGCGCTGCACCAGCAAGAGCCCCAGTTGGGATTACAGGAAACACGCTTAGCCCACAATTGATCTTCGAGTCCATGGCCAACCGCACGA
AGCCCTTCTCTCCCCATGACGAGCCGTACGAGTTCTTGAGAATCCAATAGTCAGTGCCACCGCTTGATCCATAGCCGACGAGTACCAGAGCGTGGTCAAT
ATCTCCGCTGGAAGCGAACTCTCCATCATTGGGGCACGTGTAAACGCCGCCCTTGTAGGCGTCGAAGGAGCCGCCAGAGTTGATCGCTACCGAGATAGGT
TGCTTCTGCAGCGCCAGCTTCAGCAGCTCGGTCGGGTCGCTGCTGATATCGCATGATGTCCCCACTACCTGCTCCCACCCAGAAATGCTCGCAGCAGCAT
CGTCGGCTGACGAGTTGTCGCAAGCTGTTGCAAGCGTAGCGGCAGATGCCTGCGAGGTGTCCTCCTCGTTGTAGGGCAGGTCAAGCTGGCTCAACAAGGA
CCAGTGCAGCTGAGACGCATCGGCGAAGGCGGCGTGGGTCATGCCTCCGTTGCACCCGTTGTTCTTAGAGCCCCAGATCATCTTGCTCTGCAGCCAAGAA
GACCCATCCACGCCACCTTCAGCCCAGCAGTAGTCGAACGTGGCCGTCATCTCCCTCGAGCTGCACTCCAAGAACTGCTGAGGCGACAGCGACTGCGGCG
CTGTCCCTGCACTCACTGCCACCGCCGTCTCGATGCTGTCGGCTGCGGCAAAGGCCCAGCAGCTTCCGCACTGGTTCTGACTCTTGACGTCCGTGCAGAT
GCTGGTGTTGTGCGTGTTGTCCGTCGAGCACCAGTCCAGCGTCTCGCGTAGATCGAGCGTCGAGTTGGCAAGCCGGCGCTGCTCCGTCAGTCGGCGTTGC
CGTTGGCGCAGTGCCGCTTGGTGTTCCTGCTCCACAAAGTCTGAGGGCGATAACCTCCTATCGCCGTCATGGTACAAGTGTCTAGAGTTGACGCCCATGG
CGTACGAAAAGGCCCAGCCCCGCGCTGCCGCGTGCTGCTCCACCTGCTCCAGGTAGTCGACGTGCGCCTCCATGCGGCGTCTGAACTCGCTCGGACCGGC
GTTCATGCCTTCGTCCTGCAAGAACTGCGTCACCATGGCGTGCGAGGACACCGCGACGCCGTCGCGGTCCGCCCACAGGCAACGCGAGCCCTCGCAGCTC
AGCAGCGTGCCAAAGGTGGAAGGATCCAGCGCCTGCGCTGCGGTGGCCGACGTCGCCAGCGCGAGCCACTTGGTCCAGGACCGCGCCATGCTCCCGAGTG
CTCGCTGCTCGGTTGACCCGCTCCTGCCTGCCTCTATAATGGCGCGCAGGTGGCCGGAGATGGCCGCTGCTCGCGCGGTGGCAGATGTGGAATTGTGATA
TTGTCGCCTCGTCCGCGGAGGCGTTTGATTGCGGTGGCATACAAACTTCAAGTGTTGGCTGAGTCAACCGACCCTATTTTGCAGTGAAGCAAATGGACCG
AGCAGCAGCCGTCGCCGGGTGCACAACCATCGGTTGCTGTCCATGGGACTCCATCGCCTCGCCTCAGCTCGAGATGACCAGACTATTGTGGGAAGCTTTG
GGACGCAGTGCACTTGTTGAAGCATCTCATGATGCATGGGATGTCCGAGCCGCGTCATGTTCACGGTCAAGGTTTTGCATGGCCGAAACCTGGATTCTCA
GCCACGCTCACGAACACACGTTGAAAGAGGGTTTGCACCAGCGCGCTGGCTCGCTTCAGCTGGGCTTTCAGTACTTTTTGTCAGGATTTCGTGAAACAAC
TTGCACAATGCTAGCGTAGCAGTGCTTGCATCTCCTCAACCCAGAGCTCATATTAACGCATCCTGACTAAGTCGCCGCGGGCGTGTTTGATGCCGCGTAC
ATGGCCGAGTTCTGCTCGCGGATGGTCTTGAGCTTCCGGTTCGACACCCCGATGCCGATGGCCGTGGTCACCAGCGTGAAAATAGTAGTCACCGCTGCAA
CGGCGATCCAAGCCGCTGGGCTGAGCCCAACGAATATCTTGTCGCCGCCGCTGTCAACGCTGGTACTCGCCTGAGCACCGGCCTTGGCGCCGGTGGGGAT
GACGGGGAACACGTTCAACCCGCAGTTGATCTTGGCATCCGCCACCAGCTTGATGAAGCCGCTGTCGCCCCACGAACTGCCGTACGAGTTCTTGAGGATC
CAGTAGTCACCGACCGACGAGTCGCTTCCGTAGCCCACCAGCAGCAGCGCGTGGTTGAGGTCGTTCTTGGACGCCATCTCTCCGTTGTTGGGGCAGTTGT
AGAACCCGCCAGCGTACTCGCCGAAGCCGCCGTTCGACGTGATGGCCACAGCAATGGGCTGTTTCTCCAGCGCTGAGCGCAGCAACGTGGTGCAGTTGCT
GGAAGTTGTGCAGTCGGCACCCACGATCTGCTCCCAGCCCGTAATGCTCGCGGCAGCCTCATCGGCACTGACGGTGCACACCGATGAAGTGTTGGAAGCT
GACGAGCTTCCTGAACTCGAGTCGTCGTACGGCATCGTGAGCTCCGTCACCAGACCCCAGCCGTTCTGGGCCGCGTCTATAAAGGCCCCGTGCGTCATGC
CGCCATTGCATCCGTCGTTCTGAGACTCCCACTTGATCTCGGACTGCATCCAAGTGGCGCCGTCCACGCCGCTGTCCGAGGCCCAGCAATATTCAAACGT
CTGGGTCGTTTGCAAGGTGCTGCAAGTCAGGAACTGCTGCGGCGATAGGGACACAGCGGCCGACGCGTTCTCCGCGATCACCACGGCCGTCTCAATCGCG
TCTGCGGCGACAAAGGACCAGCAGCTACCGCAGCTCTTCTGACTCTTCACAGGAGAGCACACGCTGTGACCCACGGAGTTGTCCGAGTCGCACCAATTCC
AATATTCTGAGCTGCCTGAACTCGACACGGTGCTGTTCGTAGTGGCCTGGAGGCGGCGCGAGTACGCGGAGAAGACCTCCTGGTCGACGAATTCCTCGGG
CGTTAGCTTGCGCTTGGTGGACGACGTCAAGTGGCGCTCATTCACGCCCATGTGATACGAGAACTCGTGCCCAATATTTTTCGCGTACATACTCACGTCT
GCAGAATGCAACTCATATCATAGTGAGAACATTTCCTACGAGTGCGAACAGCAAAACACGCACGCTCTTTATACCTTCGATGTACGTCATGTGCTCCTGC
AGGTTGCGTCTATAGGCTTCCCTGTCGCTGTAGGACACATAGTTGTGCTCGATGAGGAGCTCACGCAGAGTGCGCGAGTCCACCACGTCTCCGTTCACGC
CTGCCCAGAGGCATGACGAGTCTGCAGAGCGAACGGCTGGGCAGTCGACCAGAGCGCCCAGAGATCGGTCTGTGGACTGGACGGCGGCAGCGACCGCCGC
GAAGAGTGCCAGAACTGCTGCATGGATTCGCATTGTTCTGATGTCTGTGGTCTCGGTGGCTAAT