Description :
From Genome Similarity Track
Location :
Scaffold_170:58175- 59739
Transcript NameFunction/comments
Physo_144165hypothetical protein

Sequence
1564 bases(100 bases per row)
ACGGCGTACAAGTACGCCTGCACCGTGATGCTGAGCGTAATTCTCAGCCCGGCGGCGCCCTCGTAACGATCTTCAGCTTCCAGTACCTCAATGGGTGCAG
CGTGCAGCGCCACGTCCTGAGCGTTGTCACCGAGCCATGCGGCTCCGTCCCCATCGTTGTGTCCGACTACTCGTCGTCGACCAACAGCACCTCGAGCAAC
AACAACCTGGGCTGCGAGGCACGCAGCGAAGTATACGCATTCATCTCCGCCGCCTCTCTGCCACGTTGACCGCCATCGTACCGACTTCTGTTTGTAACTC
TCGAGTCCAGGAAAAACCTGTTGTTTGAGGTCGTTGGACGGGTCTACAATGGCACGCTCCAAGTAATAAAGACGAGAACGTGGCGGGTGCCCTGACAGAG
CGCGAATCGCCTCCCGACCCAGAGGAGCAGCGTATACGGTCTCAACGGTGTCAAGACCCCATCGGCCATGTCGGCGTGTTGAGAGATGTCGACATCAGCG
CTCTCCAGCTGCCGTACGCCTTGCTGGCGGTTGATATGAGTATTTTTGTTGAACGTAAGACCGAGATGCTCGAATACAGCCTCGTAGCTTTTCTTGTGAG
TGTTGTATGAAATGGCTTTGTTTCGATCTCGGTCACGTAGGAACTTGATGTCATACCAATCCTCCGATCTTCGAAAACACGGAAAGGGTTCACAGTTGAG
ATGAAAGCGCTCAAACAGTAGAAAGCAACTGCTCCAACTGGGCATAAATGAACAGCCTTATTCCACATGAAGCCAACGTGCTGCAGCTTTCCAAACGTAT
TCGTTTTGTCGTGTTGGATTAGCAGAACCAACGCAGTGCATGGATGGAACCCCTCTTTGTCTAGTTCCTGAGAAAACATGTCGGCGAATTCCAGATCACG
AATGTTTTCACCTCGCAGTAAGCCGAAATGAGATACCAAAAACGCCGCTCTTCCCATGAGATCGTTCAAAACGAAAAAAAGTATCACAAATCTGAGTGAA
TTGGGCTTCAGACTGGTAGCCATCTAGCAACGATCCCACGCCGCGATCTGTGTAGTTTTTTTTCGTGTCGCCGTAGTTTCCGCCTGGACGGTTGAGAGCA
GTTGCTTTACCTTGTACGTGCGAGGGTGGTCGTTACCGTTCATCTTGTTCGCCACCTGCTGGTTGTGTAGGTCTACAATAGCGTTGACGTAGCCGTACAC
CGTTGATGCCCCAATGACTTTACCCTTCTTCTTCTTCGACTCTCTGCCTACGACTTGGGTGTCCAAAAAGAGATGAAGCTTGCTACCAGTGACAGTAACA
CCATCGCCAAACCCCATCAATTGGCTCCACTCTGCAAACTCCTTTTGGTAGCCCTTGTACTTCCGTTTTGTATTAATCGGCCGACTGTCAATAGCCTTCT
GAAGGGTGGCCCGCTCTCGCTCTTCCATGAGCACTTGAAGTGCACTATCATTTTGCTGTGAATGGCGAACAGGGTTCTGTGTCGCGTCGTGCCGTCGCTG
AAGCCGCAGCTGCATAAGCGCGGATGGAGATGCCTGACTTCTTCTTATTATTATTCACCATGGT