Description :
From Genome Similarity Track
Location :
Scaffold_914:5817- 7201
Transcript NameFunction/comments
Phymu_g12340hypothetical protein PHYSODRAFT_288740

Sequence
1384 bases(100 bases per row)
ATAGCTTGATTTGTGTCATTGTTGTTAGTTGCTGCCTCAACACCGCCTCATACGCCCGGTGGGCGGGTTGCGATGCAGTACATCGTCTGATTATTCCACA
GTCAGCACCTTGAGCATGTTGGTCGAGCCCGAGCGCGCCTCCACCATGCCGTGCAAGGCGACGACATTGTCGCCGGGCTTCAGCCAGCCAAACTGCTTGC
CCAGATCAGTGGCACGGAACAGGATCGAGTCCGTGCCGATCATCGAGCCCATGCAGCGTGCAGTGACGCCCTTGTTGAATCCCTCGGCCTGTCGGGCAGT
TCCACCCAGGGCcgtcaacaccagcaccggCATCGACGGACGGAACTTGGACACCAGGCGGGCCGTGTTGCCAGACTCCGTCAGCACCACGATCATCTTC
GCGTTGATGTCGATGGCTGTCTTAACAGCCGACGACGTGATGGCCTCCTGCGTGTCCATTTGGCCGTACGTATCGAGCACCGAGTTGTGCAGCGCCTGGT
ACAACTCGTTGTAGTGAATGGCACCCTCAGCTTGCACGCAAATCTTGGACATCATCGCCACGGCCTCCGTCGGGTAGTCGCCGTTCGCGGTTTCACCCGA
AAGCATCACAGCGTCCGTCCCGTCAAGAACggcgttggccacgtccgTGCATTCGGCACGGGTCGGGCGCGGGGCCTTGATCATCGACTCCAACATCTGC
GTGGCAGTCACTACGGGCTTACCAGCAATGTTGGCCTTACGgatcatcatcttctgcgCCAGGAACACCTTCTCAGGCGGGATCTCCATGCCCAGATCAC
CACGGGCAACCATGATGCCGTCCGTCTTGGCCAGGATCTCGTCGAAGTTCTCCAGTCCTTCCTGACTCTCGATCTTAGCGATGATCTTGATGGCGCGGCC
ACGAGGGCCGAGCACCTCACGGATGTTATCGATATCCTGGCCCGTGCGAACAAACGACGCGGCAATGTAGTCGATGCCGTGCACCAGACCGAAGTTCACG
aggtcgtcctcgtccttctccgtcaAGGTCGGCAGCATCACCTTGCAGCCAGGCAAATTCATGTTCTTGCGCTCACCGAGAGTGGCCGAGTTGTTGACCC
GAGTCACGACGCCGTCTTCCTTGATCTCCGTGACTGTGAGCACCAGCGAGCCGTCGGCCACAAGGATTGAGCCGCCGACTTTGACGGACTGGGGGAGCTC
CGGGTACGAGCAGGCGATCTTGGTCTCGTCACCGAGGAACTCGTAGTCCGTGGTGAGCTCCAGCGTGGAGCCCTTCTTGATGGtgatcttgtccttgttA
GCCAGGAAGCCCGTGCGGATCTCTGGGCCCTTAGTGTCCAGCATGATGGCGATGTTCTTGTGCGGGCGTGTGGCCAACGCCGCG