Description :
From Genome Similarity Track
Location :
Scaffold_1472:5816- 8304
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1472-snap-gene-0.6Brefeldin A-inhibited guanine nucleotide-exchange protein
Pytar_ATCC12531maker-par_contig_1472-snap-gene-0.5Gene of unknown function

Sequence
2488 bases(100 bases per row)
GACACCAGTGGTAGGTTGCGGTGTGACAGACGGCGCGCATTAATGGTGACCTTCTTCGTTACTTCGATAATTGCATCTTCGATGAGGCGCATCCATTCCA
TCTTCGCATTGGCGCTGTCTGCCAACACCGTGAACGATTTGATCGGGTTTGAAATCTGGAACGCGTGCTTAAGCAGGACGCTTTCCGGAACATCACTCAC
TCGCGTGAGCTTGAGCCTCAGAGACTTGTGCGGGTTCCAATAGCCCGACATGCCCTTGTCTGCGTACAGCAACTGATCGTTGAACAGGAAGAACCGGTAC
GTCTGGTTGCGCGAGCGGCATTTCTTGGTCAGATCGCCTTCGCGAATGAAGTGTGTCGAGTCTTTCAGGTAGTACAGGCCCCGGTTGATGCGCTTGATGA
CTGAATTGAGCTCCTCGGACCTCTGGCGACGCTGGATCGTTTCTTTCATCTTGTTCACAAGCATGTGGATATCTCCCATCACTCGCCAAGGATCGTCGCT
GCTCGCCGCGGACTCGATGTTCTCCATCCACTCGGTCGCAATGGTGGGCGTCACGGGTGAAGAAACATCTCCAGGCTGTGGGTCGTCTAGAAGACAGGGT
TGCTGCTGCTCATCCAGTAGTGCGTGCACCTTCTTCAGCAAGTTGCAAAAGGCGTGTCGTTCAACGGGCATGCCCAAGAACAGACAAGTTGAAATCGAAT
AGCGAAGCAGGTCGAGGCAATGCATCGTCAGCGTGAGATCGGACTGAGCATCGCACAGAATCGATGTCGGCAGTGCCAGCAGGTAGAACCACACACGCTC
AAAGAGCACCTTGATGAGCTCGGGACTGATCGAGGCGTCGACACCGACGAAGTTGAAGACAAAGTAGGACTGCGACAGGTCCTTCATTAGTTCCTCCGAC
TGCGTCATTGACTTCACCACGCTGGTACGAAACTTGTCAACGTCCATGCTCGCGAGTGATAGCGTTGACTCGCGATTTTTCGGTACAAAGCTACTCCCTT
TGATGTGCATCGGTCGACGGGCGATGTCGTCATACACGTCCTCAAGAAAGCGCCGAGGTAGGTCCTTGCCGTTATCAATACCGCGGTTATTCTTGACAAA
CTGGTCCTTGGACATCTTGTTCTTCTTGACTTGCGGGTTGTGGAGGTCCGTGTTGAGCATGATGATCGAGTACGCGATAATCATCGCTGTGTCCGCGGAC
GAAAACGAGCTGGGTGAATCTTCCCAGAAGCATTGCGCAAACGCCTCGACCATTCGCTCGATCTTCTGTGCTTCGCCAGGCAAGCGAAATCCGCCATTCG
TCAGAAAGTGGCGGAGTGACTCGACGAGCGTCATGCCCTTAAAGGAGATTGCGCGGACGTACGTCAGCCGCACTTGAACTTTGAAATCTTCGTCGCCTTC
GCCGAGATAATCTCCAATCTCTCTCTCGTCGAAAAACTCGTGGTAGATCCGCAGAAAGGATGTGATGTCTCGTGGGGTTTCCTTCACAAAGTTCATGGCG
ATGAGGTACTCGATGGCTTTCTTGAGGCTCTTTGTGGATGCAATCTCCATGGCACGCTTGAGGAGTTGTTGGTTCTTCTTTTGAAGTTCATTCCGCATAC
GAACGTTCATGCTTCCGTAACTGGGGTTCAGTCGCCGTGAACCGCTCAGCCCCCTTTCTCTCAACTCGACCGTTTCTGTGGCTTCATTGGGCAGAGGTCT
TGATTTTTCCGAGCACGAAGGAGCAGATACCAGTTCGCTACTTGAGCCCACATCTTCAGTTTGCTCGTCTTGCTCCCAACCTCCTTGTTCCATCGACAGA
AGTCGGGTTCTTGCATCTCGGTTGATTAGATGGGCGTGACCACTTGCATCCATGACACTCCGCATAATCGCAAGAATGGTGGAGATTGCCTGAATTTGCA
AACGAACTCGACATAAATCGCCTTCTTCTTCGCCCAATGGAGTGTTGCCAATGTTGCCTTCAGCAATGCTACAGAGCGTAGCACAGAGATGCTCAAAGAT
CTTCCATTGCTGCACGCGCTCCATGTCGTAGTTCAGGAAAATTTCGACAACGTTGTGCGGAAGCTGGAACCACGGCATGATCTCGTCCATGATCGCCATT
TGATTGCTCACAGCGCCGGATGAAGTGCTTCGCAGCATGCGTAAGAACAAATTCTCAAACAACAGCGCAAATTCGACCTTGAGGTGACGTCGATAATGGT
TCCACAACGTTGAAATGAGTGTCAGGCTGGTTCGGAACACCTCGGGAGACCACACCAAGGCGGTCGAGTTCACGTTCGAAAAAACCACACGACGAATCAT
CTGACCAAACGCGCGATGGTCTCGCACGTTTGCACCGGCCGCGTGGAGCGCGACATTCAGAGCACGTAGGGAGTTCACGATCGATACTTGTTCGCGCTCG
GATGCTTCTTCACTTGTCAGGAACAGTTTGCGGCTCACGGATTTTGTAAGGGTCACAACGAGCTGGAATGCATTCTTTTGTGCCTGAA