Description :
From Genome Similarity Track
Location :
Scaffold_7:581441- 588575
Sequence
7134 bases(100 bases per row)
GCAGGCCCCCCGTCTGGCGGATCCAGAGTGGGAAGCTCGCCAAAGACTGTCAGAAACAATTGTAGAGGCAGCCGTAGCGACAATGCTACATACGTTGTCG
CCGACAGAGCAAAACGGTGTTGCTCTGGGATTCATCGTGAGCGAGCACCGTGATGCTGTTGCTTCTACAAAAGTGTCGACTGGGCCGACACCACGCGTAC
AGCCGTTGAAACTGCACGTGAGCAATTATGTGGGGAAAGAGCGAAAGCCTCGTCTCCGATGGCTTGTCGAACTCGACACTGTCATTTGGGCTCGTCTTAT
CACTAATGAACCGTCGAAAGTTGCGTGCACCATTTCATGCCCTGGAGGACGAGCGAGGAGCTGGGCGTATGGCCGCCGGCTCACAGATCATACGTGCTTT
AAAACGTATGCAATATTCAATGAGGAGATCTGACAAGCGTTTGAGCCCCCTCAGAATGAGCTCCGATCGAGAGCGACGTTTCTTAACCTGCAGCAAGGTA
AGCATGACGTTCATGCTCACGTCCAACGTGGTCTCGGGCATCGTGGCCAACCTGATCGACGAGGCGCCAAGCTCGTCACGTTCATAAAGGGGTTTTATGA
TAGGTCTGTGAAGATCTATCTTTTCCGAGCGTACCCGAGTACTCTTGAAGCTGCGATTGCTGTTGCGATGCAAGAGGAGTTTCGCCTGAAGCAGACTAAG
CTGCATACGAATGTGCCGAAAATGACACGTCCGATGATGAGGACGGGAGGTCCAAACCCTATGGACATCTCGAATGCTTCCGCTGTTGGACGCGAACTGT
GCATTGGGGGACAAGTGCGGTGTTTCCGATGTGGGTACACCGGGCACTTTGCGCGTGAGTGCACAGCGCCTGTGCACTCGGCCAGGGGCCGACGTGGCGA
TGCCGGGCATCGCCGCATACAAAAAAAGCGTGCAGAACCAGTAGGGGCGAGGCGCCCTACTGGTATTGCGGTCACGCGTGTAGACAACGGACACGCGACA
CTGAGGGCTGCAGCCTCCAGCAAGAGGTATTCTCGCTGCAAGAAGCAAGATGACAAGCCAAATCTTGTCATCCCGAAAGTACGTCAAAGAGAGCTGGCTC
TCTTCGTGCTTGGTTGACTCAGTGCGTCAAACAACTTTGTTCGACTGCGAAGTCTCTTGAAGCTGAACTTTGAGGAAGCTAAAACACCTCGAAGTGTTTT
AGAGGTGCGGTTGGCAACAGAAGCCACCGTAAGAACGAAGAAGCGCGTAGTACGCGTGTGCTTCTCGTACAAACACCGGGTATTTGTAGAAGTTCCTATC
GTCCTGGAGCTGGACGATAAGTTTGACTTGGTATTTGGCATGTCATGGCTTGCACGGCATGATCCAGTGATAAACTGGGAGAAGTGTTGACTTGTACACT
TCGGACGCAACGCGACAGAGGGCGATGTCACTATCAGTGTCGCGCATGCGCCGCAAGGTGCTTCCGATACCACCGTTGAGGCAGCACCGTACGACGCACG
CTCCGATGCCCATTCACAAGTCACAACGACTGAGGCAGTTGTTGAGTCTGTCTCATATCGGAAATTAGATTTGAGACGGTTTCTTCTTCAATGACCGTAT
CAACTTGGGGAGTTGATCAATCATCTATGGAGGATCTTCAAGTCAGAGGCAGTGGCGGTGACGGTGGTGCGTCGGTCCCGGGGATTGACGCGTCAGATAT
GCAAAGGACTCCAGCTACAAACAGTAGCTGCGAAACGGAATCGAATCACGCCGGGCTAGATCATTCGCGTCCGCGAAAGAAATCCGCCGACGGCTACAAC
GGAAATCCGCCCAAGGCCGGGCCTGTATGAGAAACAGCGGGCTTCACAAGAACAAAATGCAGCGCAAGCGACGAAAGCTACGCAAGTCTCGGTCCGGGAC
CGAGGCGATACGAGCGAGGTCTTCCGGCCAGACATCGGAAATGACGCGGCCCGCTCTGGTCTCCACAACCGGTCAATGCAATGGGGGAATCCTACGACGA
GTGCGTTTGAGTTGACACCGCTTCCTGTCATGAGCTGGATGCACTTCGCGAAGGACCTGTGCGATGGACGCATCGAACCGATATGCATCCTTTCGGATAT
AGAAAAGGATGGAAAGCAAAGCGGAGGATCTGAGACAACTCCACGCTGCAAATACCGCTGAGATAACGGACACTCTCAGCGCAAAAACGAAGGTTGAGCG
CTTTGAGGAGCCGAGTGGAGACTCGTTGAAGTCGAGTCCCTTCTACGAAGTTCAGCAGGAACACAAGGATGTGCTCCCGGATGAGATATCTGCGGAACTT
GCGCAGGACAAGGCCATGCAGCACGAGATCGGGCTCTTGCCGGGTACGAAGTACTATTTGCCGCACGATTAAGTAAAGGCAATCGACGACTTCTTTAAAA
GTCGTCGTAAAGCAAGTTGAGTGCGGGAAACAAAGGCCCCGCACAGCGCACCAACGTTTTGTGTCAAGAAACCACAGGGCGGATGGCGCATCGCTCGTGC
TCACAGCAAGCTGAGCGATACGACAATACCGGCGCAGACGTCTATACCACGATAAAAGTTATCGTCGATTCGATGGCCAAGAGCACCATCTACAGTGCTC
TTGATCTGCGCGACAGATTCTATCAGATCCTGATGCGAGAGAGGGACACCCCTCTCACGTCGATGAGCACTCCAAGCGGTATGCTTTTGGGGTGGCTCGT
AATGCCGCAGGGACGGAAGAACGTCCCTTCAACCTTCAATAGATGTGCTACACATCAATTGCGCTTAGTGCGTGATTTCGCACCGAGCTACTTCGATGAC
GTGTTCGTTCCCAGCCGGGATGTGGACGGGAAGACTGACGTTGAGGTGCCCAAAGAGCACCTCCGTCAACAGCTAGAGCTTTTGCGTAAACATTAGCTCT
GTGCGAACCTGAAGAAGTGTATCTTCGGGGCGAGCAAGATATCCGTCTTTGGGCGTCTCGTCGGGAAGAACGGCGTACGCCCTGACACAGAAAATGTCAG
AGTGATCAATGAATGGCCTATGTCATCCAACGTGAAGGGACTTAGGTAACGCCTTGGACTTGCAAGGTCACAGCTCCTGAAAAAGGAGGCTGAGCGGATT
TAGACGCCTGAGTGCCAACATGCCATCAATAGAGTCAAGCAGGGCTTGACGGAGCGCCGCTCTTGGCGGTGGCTGACCAAGACCGCCCATTCCACATCGC
GTGTGACGCGTTCGGTTTTGCAATCGGATGCGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTGGTCTACTACCAGTCGCGTCAGCTAAAGCCA
GCTTAGCGTCACTACCCTGTACATGACAAGGAGATCCTTGCCATGGAGTGTGCACTCGTAAATTGTATTTACTTGTGTATTTACTTGGAATAGACCGTTC
GTGGTCGACATCGGCCACTCTTCACTGCGAACGGCATTGAAGGCTCCGCACATCTCGCAACGAACGGCGAGGTGGTTACCGTTCTTTGCGGACTACAACT
TCCAGATTGAGTAGAAACTTGAAAGATTAAATATGGTGGGCGACGTGTTGCCGAGTCGACCTGCTAACGCTGTTAAGACAGCCGACGCGAATCGGATTGG
CGTCGAGCGAGTAGGTGTTTCATCGTCGTCATTGATCGACGACATGAAGATAGCGGATGCGAGTGACTCAGACGCGGAATAATTGCTAGAATATGTTTTA
GCATCTCCCGACACGGCACACCGGAAGTTGTCGCCACTTCTGCGAGCTCGTGCACACCGATATCGTGTACACGAAGGTCTTACAGCGCAGAGGACGACGA
TGCGCGCCGAATAGTTATGATCTGCGTATGCGGATCATGTACGAGTATCACGATGCCCTTACGGCAGAGCATCCGGGTCATGAGAGAACATACACTCTTC
TCACGAGAGACGTCTACTGGAACCACCCGTAGACGTGGGTACGCAAGTACGAACGTGCTAGCGAAGTGTGCCAACGCGTGAAGCCTACTGCGTATTCACA
GGATCCACAATCACTACCGATACCGTCGAAGTGTTGGCAGTCTATTTTCTATGGACTTTGTTTTCAGTCTTCCGCCAGACCACAAGCGGAGGACTGGCGC
TGTGGTCTTTGTTGACCGATTTAGCAAGATGAACCATCTTGCTGCAGTACCGGCTGAAGTCACGGCCGTGCATACTGCACGACTGGTTGTAGACATGATG
TTCCGACACCATGGAATGTCGCTGGACATTGTGTCGGACCATGATCCACGCCTTACAGCGCGGTTCTGGCAAGAAGTGCTTAGCCTTTATGGAACACAGC
AGGCAATGTCGACTGCGGATCATCCGCAGACGGACAATCAGATCGAGCGCGTGAACCGAGTGTTCGGTGACGTACTGAAGAGCTACGCACACTCGTTCCC
ACAATAAGGCGACTGCTAGCCGATGACAGAGTGTGCCATCAACAACGCGATGCATGCCTCAACTGGGCATACACCGTTTTACGTGAATGGCATGCGGCAT
CCACGCCCCCGAGGTTTTTCGGACCGGCGGCTTCTTCTTTAAGAGGGGGAGGACCTACGGCTGCGTCGATACAACTGCAGAAGAGCACTGATACCGACGT
GGCATTAACGGTGACGACGCGAAAACAAGCGCCTCCTTCCGGAAACAAGAAGAAGACAAATAAGACAGCTTATGTGCGGGGCACATGCGCCGCGAACAAT
AAGACGTCTGTGCAGGGCTCAGACAGCTCGCAGACTGAGCCTGCTGTGGAGAAGAAAGACGTCCTGAACAAGTCAGGAGCACACAGTCACTGGACTTTGT
CAAGCACCGACAAGCCGTAATACGGTTTGTCCAGGACGCAAGAGAAGCTTCTGTAGACAGACAGAAGCTGAGCGAAGCCAATGCCGGCAGAGGAAACACA
AATGAATTCAAAAAGGGTTGATTAGTTCTGTTAGCTACACAGAACCTGACACGACATGTAGTTTCCAATTTCGGTGCAAGCAAGCTTGTTCCGCGCATCA
TCGGCCCGTTCACAGTGCTTAAACGGCAGGGCAATCTGTATATACTAAACATACCGTCCGCATGCGACTCCATCCGACATTAAACGTCAAGCGGCTGAAG
CCTTACGAGCAACACGATTCATCTAGTCCAGATGGCTCGAGAACGCCGAAACGGCGTGAGCTAGCTTCTCGAGCGCGATGACGCGGCCGCGCAGGCGTCT
CAGCTCCGATCCAAGCGCGACTTGGATGTTCGAAGCCGTCTGAGCAGCCGCGGCGATCTGCGCAATTCCTGTGGCAGGGTAGTGCGTCTGGGATTGTTCC
AGAGCGATCACACGATCGCGCTGAGCGCGAAAGGCATGGGCAAGCTGGAATTGACCGTACGGAGGGTATATTTCCGCCCCTGCTAGCGCCGCTGCGAAAC
GCCCACGGCTCGACACGTTAGATTGTCGAGCGGATTGAGAGATACGAAGCCCCAATGACGAACCGACATCAGACTCGTCCTCGGCTTCGTTGGAGAGGAT
TTCCTCCCCATCGAGATACATGGGAGCCACGGGACGTCCTGATGAAGGACGTTCCGGAAATGGTGAGGGCGTAAGAGACCCAGAACCGAGTGAAGGCACC
ATCCCTGCACTAAACTGCGAGGGTCATCAGCACGGGGTGCATCACAGTGCTCAAGTTGAGCACGGAGGTCTTGAGAGGAGCGGGTACATGTACAGAAGTT
TACTCGAGAACACCGCGTTCAGAAAGGCGTACTGCCCCGATGCAGCAGTCGCGAACACGCAGATTCAGGTGGAGCTGCACAGGATATTCCCGCTGTCATA
CCGTCAATATGGAGGCGGTCGATGCGTTGACGTTTCGAGAAGGCCTCGAGGCACTGGCGAGCCGCGACAGTACGCTCGCAGTAGCCTTTCACATTGTTGT
TGAAGCTCACAACAATTGCGAGCCAAGACTGACAAAGTGACACCCACTCGGGTACTTTGCGTCTGCGCGAAGTTTTCTTTGACGCATTCCATCGGAGCTC
ATGAAAGCGTCCGATGTCGTAGTCGCACCTTTGATTCGCTAAGGGAACAAAGTGCGTGTCGATGGCCTCACCGTCATCATTGATCGCGCTGCACACGTAC
AATCCTAACGGGTTCGGCGGCGATGTCGCGCCGAACCTGTCAGTAATTTCAGATGCGGTATGCATCCAGGGAGCGCGTACTGCAGGTGCGATACGCGGAG
AACAAGGGGTCTGGCACAGGTGGCTACGCCTTTTCTTCATTGCGCGGACGCTTTGATTTAGGAGCGCCCGAATCATCGTCACGACCACGCCGCGACCCGA
CAGGGGCATCGAGCGTGGAATCGGTCGACTTAGAGCCGACAGCTGAAGACGATGTGTCCTCGTCTTCCACGAAGGTGTCTTCAATTTCAGACCCATAGTC
AATGGGTATGTCTCCATTGGTAGACGTAACCGACGCCCTCCATGACGACTGATGGCCTTTCAGTCGTAGCTTGCGCAACACCTCTGCTTATGCAGAGTGT
GGTATTGAGTGACATAAAGGTTTATTTCTGTCGCAGACGTGTTCGTTTGGGCGTAAACTGAAGTGGTGGTGTCTGCAGGTGCATACACGGACGTAACAGG
GTCTGCCGGAGCAGGCTCTTGCGCGGGCGTCTTCCTCGGCGAGCTCTTTGCAAAACGAGCTCGGTTTCTCAAATGTTTGACGGCCTCGTCAATACTTTAA
ATGGTGTGTTAACACTAGAGAAAGTCTTATCTTAACGGGGGGGGGGGGTAACGTGGCTACACGCAATGTGGCTACACATAGCAACTTGATTGCGGAAGAG
GTTTTCCACATCGGTGTGAGATACGTCAATGGTTATATTTGGCAGACTGTTGGTCTGCATGCATTCAAGGCATTCATTTGTTTAAAACATTATCTTCAAC
GAATTAGAATAGTAGGATTCTGTTAACTATTCGTTGATAAATAGCATTCATTTAGAATATTAGATCAGGAGGAAAACCCAGACACAAAAAAAACAGTTCT
CAATTTTACCAGAAATCGGCTTTGCTTTCCTATTTAGGTAAATCTATACTTTCGGACGAAAAATAGTTAATTTAAGTAAAACGCAACCTACGCTTCCTCA
TACACGTACACTAATGTGTAAACCGAAGTAGTGG