Description :
From Genome Similarity Track
Location :
Scaffold_549:5814- 9617
Sequence
3803 bases(100 bases per row)
CTTGTATTCAATCTACACCTGATTCTGGTAAAGACTGTTCCTCTGTAAGGATGGAAACAAAGATAACCCTCTCTGAGGCCCAAGGATTAGCGCTGGAGAA
ACTCAGAGTGCTAGTCGGAAACGAACAAGTGAATCTAATTCTTGCACAAGGTCCTGACGTGATTCATGCACGTCTTGACGCTTTTATGCAGTTTGTGTTC
ACTTTGATTGGGCAAGTACGCGACCATTTGGCATCGGTTATGCCTACTCATTTTGTTCCCGTACCTGATGAAGAGCCAAGGGCTCGCCTCCTTCGGTGTT
TGCTCCGCCTAATCAGACATACCGGGTGCGTTCTCGTTTCCTATCTGACCATCAGGGCAAGAAAGAAATATCGGACTATGTCTAGGAACTGGGAACTCTA
ATCACTGCCATGCTGCGTGATGCCTTACCAGAAGTGGTTTCGGTTACCATCTTCATGGAAGGTATTCGTACGGGCGTGGCTCGAATGGAAGCATTCCGGG
TACACCCCACCTCCTTTGAAGCGGCTGTGGATATCGCGTTGAACGCTGAGTTCAACTTTAATGCAGCCCGTTTTGGCATCCATGGGTACAACCCAAACTC
GGCGAACTCATTTAGTTTATTCAAAAGGCCGGAGCCTATGGACCTCAGCCTCGCCGAAACGGACGAAGAAGCAGCGCTTCGAGCTGTGGAACAGCATCGA
AACATTCGACGATATTTCACGTGCGGAAGCACAAAGATTCTGCGACCTAGTTGCCCTTTACGCAGGGCATGCCAGGCTACTTCAGGCCAAACTCCCGCCT
CTACAGAAGTCTGGTACGGTGCGGGAAAACGTAGATTCCCAGTAGGCACAGGGCGCCCTGCTGGGGAAGAATTACGTTCTTTGATCTTCTAGGAGGTAGT
GGCGAGCTGGATTTAGCCCCAAAGAGTCCCGTGCACTCTAACACGGGACGTGAATACAAGCCAGGCTTGTTGGTCGCAAAGGCGACTGTAAAGGGCTTCG
ACAAACCCTGGTTGATGTTGATTGACTCCGGATCATCCGGTAATTATGTCAGACGATGTTTCTTTGAAGGCAATCCACGTTATGTTGAGGCGCTAGAAGC
GCACAAGGATGATATGATCACTGTTCGCTTGGCGACAGGAAGTCTAGTCACTGCACCCAAAGTTCCTGCGAACTTGGGTGTGAAGTGTTTCGATTTTGAT
AGTATCGACGCTGTTAGTCCTTGATTTGACTCGAGATATGATCTCATTCTTGGTATGGCTTGGTTTGACGTCATGGAGCCATGGATCGGACTGGAGGTCC
AAAACATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGAG
CTGAATTTTAATTTTAACATTGTTGTTGAAATATCAAGGCATCCCGAGCCCGGCTCAGCGGATGCACTTGAAGTGGCACGTAATCCACGTGATGACGACA
TCATGTACAATGACTCGCTATCGGATGTCAGTAGTGACGTCAGCTCTGGTTAAAAGAGAATTACGTTCAATGACGGTATCGATCAGAGAGATACGAATCA
CACATCGTGTGTTGTGTCACAAATTGATGATGACTTTCAGCTGTATGCACTCGTCAACGGAGTGACTGGTGCCTGTGACGGTACAATTAGCCTTGAGGCT
ATACCCTCGTTAAGTTCGCTTTTAGAAGCCGAAGAGTTGTCGGTCGATGAGTTTGATCACTCACTAAAGAATGGAGACCTTTCAGAGGTGGTGGTCATTC
GACCCGACATCATAGAGCTGAACTCTTCTTCACTTTTGGATGAAGCCGTTCTGGAGGACACAAAACAGCACTCAGTGCGCGTAGTGGGTCATCAATATTG
AAAGACCCTCATGATCCCTTTTATTCCTTAGTCAAGGAATTTCAAGATGTGTTGTGCCACGACCCACCCTCGGTTCTATCTCCAGATAGAGGTGTCCGTC
ATGAAATTGACTTATTTCCTGGGACTAAATACTGTGTCACACGACAGTGGCCCTTGCCTAAGGAGCAATGTGATGTCATTGATGACTTCTTCCGTGCCAA
GTGCCAAGCACGAGGCAGGAATGGTACGTGAGAGTAAATCTCCACATTTGACACCGACATTTTGTGTCAAAATGCCGAACGGCAAGTGACGTATTGTGCA
TGCTTATAACAAGCTTAATGCGACTACTATTCCGGTACAGACACCCATTATTCGAAAGGATGTTCTTCAGAACAACATGGTTGGTTGTACTATGTATAGA
GAACTCGACTTGACCGATGGATATTACCAATTGCTCATGCGAGCGAGTGATATTCCGCTTACAGCAGTGAGCACTCCGAGTGGTATGCTATGGGAATGGC
TGGTGATACCCCAAGGGCTGTCTAATGCTCCGGAAATATTAATTTTCTGGTGACGCAACTTGTCCACCCACATCGGGATTACGTACAGACGTACTTTGAT
GGCATTTTTGTCTATAGTCGTGCCAAACAAGGTCGGTCAGATGTTGAAAATCACATCAGTCATTTGCGAGCCGTGATCGAGTGCATGCGCACTAATAAAT
TGTACTTCAACGCGTCTAAATGAATTTTTGGTGCAGAAGAGATTCCTTTTCTCGGATATTTCATTGGTAAGCGCGGCCTTCGAGCGGACCCCGCTAAGGT
AAAATCTATAGTGGACTGGAAGATTCCTAAGAATCAAAAGGAATTGCGTAAGTGGTCTGGCCTTGCCAATTACTTACACAAATACAGTGAAATTTACGCT
GATATGGCTCTTCCATTAACTGATATCCTTAAGAAGGACATAGATTGACGCTGGGACAACACCCATGCCGACGCATTTTGGTCATCAAGGAGAGTCTTCT
CCA