Description :
From Genome Similarity Track
Location :
Scaffold_463:5814- 8614
Transcript NameFunction/comments
Phyra_86100Hypothetical protein
Phyra_86101AGL178W family transposase

Sequence
2800 bases(100 bases per row)
GTCTGTCTTGCCAATTAGGTGAATGGAAGGCATCGGCACAGACATGCGGTTGCCCAGCTTGTCCAGGAACAGCGACCTCACATTGACGCCACTCACATCC
ACTCCGCCGACGCAGATCACGAGCTTCCACCAGCGCACGTTGCCATGGTGCAAGTACCACATAGTCAAAATCGTCAACAGCGCAGCACCCTGGGAGAATC
CGATGACGACGTCAAACGGACCGTGACGACGAAGTTCCTCGTCAATTCTCATCATTGACTGCTCAACGCCCTTGTAGGAAAGACTCCACGCGTGGTCTGC
TCCTTGGTCAGCCCCACTTTGCAGACGCGCCTTGGCAGACGACTCAGCGTCGTTGTAGAGCAGCGGGGATCCGTCGGCGAGTTGATTCTCAAACCATTCG
TAGAATGGAGCACTGGACGCGTAGGCACTCTCGATCATCGGATCACTTGTCCCGCGGGCTTCGTACGTGCCGTTCAGTATCGTAATGTGACAGCACGCCA
TGGAGTCCACGACTTCTTCGGCTGCTGTCTGATTCATCTTCGAGACACACAAGATGTTCTCATGCAGCTATCACCCACAATCCGCCACTCCACAGGCTAC
GTGAGCTGTAGGTAGCTTCCGTTAACGTTTGCACGCTCAATTCATTCTTAAACTTGCCACTTGAGGATCACCCGAGCTCGAACTCGGCAGAGTTCGTGAC
AGTTAATTAACTATTAGTAAGCGAGCGATGCCACCAGCAACGGATTCGGACGCACGCGATGAGCGCCCCCAGCAGCGTCCACGTGTCAATCCGCAAGGGA
CGCGATGGAATGTGCCCCCGGAAGGCTACACCCCTCCCCCACCAGCTACAGCAACTGGGCAAGGTGAAAATGGCACCTCAGCTCAAGACGCTACGGCACA
AGGCTCAACGGCAACGTCATCTTCCGCACAGGCCTCTTTTACGCCTGACATGTTGGCGCAGTTGCTGCAGCACACGCTGCAAACCACGCAACAACAAGCG
ACGCAGATGACTCAACTCCTGGCGCAAACGACGCAGATCCAGCAGCAGATCCTGCAGACTCAGACACGCCCAAGACCATCTCGAAAGAAGTCCAATCCAC
CACGCTTTGATGGCAGCGATCAGGACGACTTGGAGCTTTGGATTTTCTCCACAGAGCAGTATTACTCCGAGTTCCGTACGGAGATGCACGACTTTTCGTC
GAACTTCTCGGACATGGCCTTTGCCAACCTTGGCACGGACGCCCAAGCATGGTATCGTGATGTGAAGATATCGCTTGGGGCCAGTCCGCTTACATGGAGT
GTTTTCAAGGAGCGTATCCGGGCGCGGTTCCGCGATAAGGACTTTAAGTTCAAGACTCTGACCAAAATGTACGAGTTGAAGGCTACAAAGTCCCAGCAGG
AATACACATCTCGCTTCCTGCACTTGCTCTCGCAGGTGGACACTGAACTGCCTGAAGTCGTCAAGCGCTGGTTTTTTCAGCAAAATCTGCGTGCAGACAC
GTCAGCGTACATTTCGCGAAATGTGCCTGACACTCTGGAGCAAGCCCTCGAAATGGCTCAACGTTTTGAGGACGCAAAGCCCGCTAGTACGCGGCCTCCT
GCAAAGGAGCTGGCGAACCAGAACGCCAAACCCAACTACAAGTCAAAGAACAACACCTCCAAGGACAACACGATCAAGCAGTGTAATTACTGCAAAAGGA
AAAACCACACGGAGGACGAGTGCCGTACGAAGGCACGCGACATCGCCGCTGCCGCAGAATCTGGGTCGTCAAAAAATGGCTCAGCTCGGTAGGGTGGCAA
CCTACCGAGCCAACAAGGTCAGAAAGCTCTGGCAGTAAGCTTTCTGCACCGCCATCGTCTGGTGAAGCCGCTAGCAGCAGCTCAAACCGCCTAGCTTTTT
ATTCGGACAAACTCTACTGCTATTTGACCCAGGACGCACAAATTCACAACAACGTTGCTACGTGTTTCGTGGACAGCGGGTCGTCATTCAACGCCATCTC
CCCAAAGCTGGCACAAAAGCTGGACGTCGAAGTGAAACAATGCCCTGAACCGCTATCAGTGAAAATCGGAAACAATCAACGCATCACAATCCCGCGCAAG
GAAGCCGTTCTTACCGTTAAAATCGAAGGCTTTCCCGAGTACAAGTCGTCGATGTACGTCATGCCCATTCCCGAGGACAAGGATGCGTTACTCGGATGGC
CATGGCTTGAGCAAGTGAACCCGGGAATCGACTGGAGGAGCCGAACAATATCATTCCGCAACGATACCCAGTCGTCCACAATTTCCTTTCGACAATGCTT
ACGACACGCTCCAGCTCGTAAGGTCGGCCGTCAACGCCTCAGAAATGGTCGCTGTACTCGCGAGGACGATGCTCTCCAGTACTTTTACATGCATCATGAT
TTTGACAGTGCACAAGGATTAACTCGTGTTGTAGCAGCAAAAGACCTGAAGAAGCTACTGCAAGAAGAAGACAACGAATTCGGCTTCGTGATTCAGCATG
ATCCTGACAGCGCTAAAGCAGACCGGCAATTAGCTCAAGACTGGGATGCACTTCGCGGACACCCTGCCGAATCACTTCTGCTAAAATACAAAGACGTCGT
CTTCCGAACGCAGCTTCCTACAGTACCCCCAACGCGAAACGAGGATATCAAAGCCGAAATCGAACTGGTGGACGATGAACCCGTAGCGAGAAAGCAGTTT
CGGCTCAGCGAGGAAATGAAGACCGCAATTCGTGAGTGGACAACAGAAATGCTTCGAGCTGGCATTATTCGGCGTTCGAAATCACCCTACTCAGCACCAA