Description :
From Genome Similarity Track
Location :
Scaffold_1216:5814- 7009
Transcript NameFunction/comments
Phyta_totarag12426hypothetical protein

Sequence
1195 bases(100 bases per row)
CACTTCATCATACTTATGCCCGACGACAGCACAAACTGCCCACTGGTTGGCATGAAGATAATCGCAAACGGCTTTGTCCGGTCGGAGCGACGGATTAATG
GCGTCGACACAATCTTTCGCTTGCGAATCTCAAACGCTTCCTTGGCTCTGGACAAATCCCTTCCTGATCGCATTTGTTcttccttgagctcgtacaGGAT
TGCAGCCACAACTGGGAAGTCTTCAATAAACCAATGATAGTAGGTGAGACTTACTAGAAGAGACTGTACCCCTTTCAGAGCCGATGGAAATGGAACGTCC
TGGACGCCTTTCATTATCTTTGGTATGGCTCTGATCCCTTCCCCACATATCTCATGAGAAAGGTACGGGATTGACAGTTTCCAAACCCGCTTTTGGGGAG
GCTCACCGAGATATTCCAGTAACCCAGTCTGAACACCAGTGCATTCAGGTCGTTGCAGAGTTGATTCCAGGTGGGCGCCCCATGAACGATGTCGTCGATA
TACAAGCTTCGTCCGAGAACCGGTCACATCTGAGCCTGCGCTAGGATATTCCGCTTGAACACTGTTACCCGATCCGTCAGGGTAGGCACCTTCCGTGCGG
ACTCTTCTCGTTCGGTTTCGTTGTGTTCAGACGGGTCTCCATCACGTCTCCATCCACCCATACTTCTTCCTCTCGAGGGGATCGTACGAAACCCCAGATG
TAATTTTAGTGACAGCATGGTAGCATTCTTCAGTCTCAATGGCATGCGCATCCATTGGAAGTGACCAAACGCAGAAATCAAATAAGCACGTTCGGTCATC
CGGATGTCCCATAAGCCACTAGCCATGTATAGACTCATGAACCACATCGCTCTGTCGAAACCGATCAGCAGGTCGTCAATCAGAGGCAGTCGATAGTTGG
ACAACTTGATAAACTCGTTCACTACGCAGTAGTCAATACACATCCAGATGTCCTTCCCATTCTTCTCCAGGATGACCACAATTGGCAAGACCCAGAGAGA
GAGTCCAAAAGTTCGATCAAACCAgtctccagcaacttcttccttTTTTTCAACAACTCATACACTTTCGGCTTGAGACGAGGCGCTATGGCTCTTGGGC
ATTGAGCGACAGGATTGGCGTCACCTACGTCTTGATCACACACACTACTCCTCTGGCCGGAGCCAGAGCTGCATTGCCGTCACCTCAGGAAATAT