Description :
From Genome Similarity Track
Location :
Scaffold_1:5813807- 5814881
Transcript NameFunction/comments
Physo_345433acetolactate synthase small subunit, putative

Sequence
1074 bases(100 bases per row)
AGACCGCAGACGCTACCAACACCTCTGCGGTCGCTTATCCAGGGGGAAGACGCGAAACGTCAACCTCTACGTCGTCAGCTTCGTCCAGAAGCGTACGGGT
AGCGCCCTCAAACGTCGAGAGGTCGCCCAGCTTGTCGGTCACACTGGTGCTGCGTGCCATAGCAATGACACCGCTGCGGTGGATCTCCGTGATGCCCAGC
GGCTTCAGCAGGTCCAGGAAGGCCTCAATGCGGCCAGGGGTACCGGCCAGCTGCACCATGACCTGGTGCGGTCGCACGTCAATCACCTTGGCGTCAAACA
GGTTGGCGAGCTCCACCACCTCGGCACGAGATCCAGCCTCTGCACGTAAGACACAACCAACGTCAGGTCCACGAACAAGATTCCGGCGGTACGGCATCAA
TATAAGGAGCGTTGAGCGTACCGGCAGTAGACACCTTGGCCAGCATCAGGTCGCGCTCGACGTAATTCTTCTCGGCGTTCTTGCCACTGCTCAAGATGTT
GACCACAGCCACGTACACGACGTCCTCCAGCTGCTTCTTCATCTGCACCACCACAAAAAGCCGTAACAACGACGGTCAGCAGCTTGTTCCCCCTCTTTAG
CGCTCAAATATCCATGATCCGTACGTTGACAACGCTCTGAGCAGTGCCGTTCACGACCACCGTCATGCGGGAGAGCTCCTCCACCTCCGTACGGCCCACG
ACGAGACTGTCAATGTTGTATCCTGCATCAAACAAAACACCAGACACCCAGTTCAGCACCTGCCGCCTTCATTGGGGCGATTGGATCCTAAAGATCCTTG
CGTGTCGACCCTTACCTCGGGCGGCGAAGAGGTTGGCGATCTCGGCCAGGCAGCCAGGCTGGTTGACCACCAGCGCGGCGATCACGTGGCGCTGGCTCTG
CTCCGCCACGCTCAGCGCGCGCGAGAAGAACTTGGGGGCGGCGCAGGACGGCGCGACGGCGGCCGCAGAGCGCGGGAAGGCGCGGCGCGCCAACGGGAGC
AAAGATCTCCGCAGCATCTCGTCGAATGTCGAATGTGACGTCTGAACATCGTGGTCCCAGGTTCTACGTCGGGT