Description :
From Genome Similarity Track
Location :
contig_1:581302- 583830
Transcript NameFunction/comments
g197.t1hypothetical protein

Sequence
2528 bases(100 bases per row)
CTGCATACGCGATTCGACAGCTCGACGCGTAGGCTTTCTCTTGCGGTTCGAGCGGCGTGCACTTCCAATACTGTCGCGCATCACACCACTAGCGACAGGA
GAAACTTCGACTGACGAGGGCGTCGGAGTCGGTTGAGTTGGAAGGTCCGTCAATTCAGGAATGAGGTCTTCTTCATCCAGCGCCACCGTATCAGCGCTAC
TTTCTGTAGAAGCCGGGCTAGACATGCCCTCCTCCAGCCGCATATCACCATCACTATCCGGATCTAAATCATCATCTGCAACATCTGTCAGAAATGTGGC
GCTGGCAATATCTCCTACGAGTACAGAGTCCGTGCCATCCACATGAATACTGCCGTCTGTTTCTGAATCCGAGCTCTCTGCGCGCGAGGAATCTTCACGG
CTATCCGCGTGAGTGCTTGTCAAAGCACGGTCTGCAGCTGTGCGTCTGCGACGTGGCCGAACAAACTGGCGACGGCGACTATCAGCGCCAGGGCATGGTA
TGCCTGCATGAATGCAGGCAGCCACAATATGGCAGCACATGCCGTGCATTCGACTGTAGACACACGTACACGCCCTGCTGCGAGTGTCGACTACCCGTCC
CCCTTCTGGCATCCCTTCAGTTTGCATCCGACGTGCATTCATGGATTTGATGGAGCGCATCAGCTCCTTTCGCTCATCGGCTGTCAACGCACCGGCTCTT
TGATTGACGACGTAAAAATCCGCGGATAAGTCGCCGACCGGAGGGATGCGCCGTACGGATAGCCAGCCACGACTGTTCATAAATCGATAAAGCTTGAGCG
ATCGGTCGGAAGCGGCAGCGACCGTGTCAAATGGCACGTCTCGATTCTGAAAAGCGAGCTGGGCACCGTTGAGATTGCCGACCAACTCTCGGGGTGTAGC
CAGACCTTCCGCACAGTGCAACTTTAGTGTTCGATGATATTGCTTCAAAGGGTTATTTGAAGCGGCATATCCACCAGGTGTGTAGAACGCCTGCCAGCGG
GAAAACCGGGTCGAGTTTACCCAAAACCATTTCACATGATCTGTGAGTTTACGTACTGAAGAACCGAGACGAAACCTGTCCCATCGCTCCAAAACGCAGG
TCTTTACAGCAGGAAATGCATCTTGAGTCGCATAATGCATGTCGTACAAATCCGCAAACACAACTCGTGTATCTTCTGTGCTCGCACGGAATGTGCGAGC
ATGTTTCCACACATTCTGCGTCACGTGAAACCAGCACATCAAAATGGTTGTACCTGGAAGCTCGGCCGAACAGGCGTTGAACTGCGCATTGCAAGCATCT
GACATCATGAACTGCGGCGAAATGGCATCCAAACACACGCGCTTCATGAAGCTGATGCACCATCCGACGTCAATTGCGCGCTCTTGAGATGTGCAAAAGT
AAGCGAGCAAAAAGAACTGGCCGCACCGATCTGAGTATCCAAAGGCGAACACGTTGTAGCCGTTGATCACCATACTGTGGGTGCTGTCAACGTGAAATAT
CGTAGTGCAATCCGACCGATTCTGCACTGCAATATAGTCACGGACGAGACGTAGACGCGTCATGCCAACACGATAAGGAGAATCCTCAGATCCGTCTCCG
AGATGTGAGGCGCTGCTCGCGGTACCGGGCATATCACTTTGTTGCGCGTCGCACAGTATCATCATGTCGCGCTCAGGCAGCGACTGTAGATCCAGCTGAT
CGTACAGATTTCCATCGCAAAGCTGAATCATCGGCGCAATGGAATCTCGTGGGTTATCCCACCTCCAGTTTTTGACAAAATCAGTCACTTGAGTGTCTTT
CGGAGCAGGACCTGTGATCACACCTGCCTCGACCATGGCGCTGAGAGTTGTAAACAACTTGGTGGCTGTTGTTTTGACTCAACTACTTAGCTTCTCGTTA
GTAAACGTCTTCATTGCAGGGGAAATCTTGCGCTCTTTGGAGTTGGCGGATAGGTTCTGTGCATGACACGCTCGCCTTGCTGAAACACCTCACAGGTGCT
AGAGGACAGACAGATCTTGAACTTGTCCCGACACGGACATGATGCCGTCTCTGTCGATGTAGCGTCGTCGTCAGGGGCAGTGAGTCTGGCACGACACCGC
TGAGACCGGCACAGTACCATTTGAGACCGCATTTGATGCATTCAGCAAGCTAGATCGAAGTCCTTATCAAATTTATGATCCACAGAACATCCCCACTGGA
TTACTCTTGTCGATACAGTGAGTTGGCAGTGAGTCCCGAAAGGACTGTAGTGCCCCCGACACTGTTGATCTCCATATCTTGGTCCATGTTGGTCGGCGAC
GCCTTGGCTGGGCCTCCTCGCCATCCGATTCAAACGTCTGTAACTGCAGAATTCCATCAGAACTGGATAGCAGCTCGCTATCGCGCTCGGACATTGTTAG
TGTTCACTTTTCGGCAATGCACGCAGGAGGCGAACAGAGAAGCATATATTGAGCTAAACAGCTACAAAAGTCACTTCAACATCTTGAAGTGCTTTTTTGG
TGTTTGTCTATTTTTTGCTGGTGGCGCC