Description :
From Genome Similarity Track
Location :
contig_1:581201- 583729
Transcript NameFunction/comments
g228.t1hypothetical protein

Sequence
2528 bases(100 bases per row)
CTGCATACGCGATTCGACAGCTCGACGCGTAGGCTTTCTCTTGCGGTTCGAGCGGCGTGCACTTCCAATACTGTCACGCATCACACCACTAGCGACAGGA
GAAACTTCGACTGACGAGGGCGTCGGAGTCGGTTGAGTTGGAAGGTCCGTCAATTCAGGAATGAGGTCTTCTTCATCCAGCGCCACCGTATCAGCGCTAC
TTTCTGTAGAAGCCGGGCTAGACATGCCCTCCTCCAGCCGCATATCACCATCACTATCCGGATCTAAATCATCTTCTGCAACATCTGTCAGAAATGTGGC
GCTGGCAATATCTCCTACGAGTACAGAGTCCGTGCCATCCACATGAATAATGCCGTCTGTTTCTGGATCCGAGCTCTCTGCGCGCGAGGAATCTTCACGG
CTATCCGCGTGAGTGCTTGTCAAAGCACGGTCTGCAGCTGTGCGTCTGCGACGTGGCCGAACAAACTGGCGACGGCGACTATCAGCGCCAGGGCATGGTA
TGCCTGCATGAATGCAGGCAGCCACAATGTGGCAGCACATGCCGTGCTTTCGACTGTAAACACACGTACACGCCCTGCTGCGAGTGTCGACTACCCGTCC
CCCTTCTGGCATCCCTTCAGTTTGCATCCGACGTGCATTCATGGATTTGATGGAGCGCATCAGCTCCTTTCGCTCATCGGCTGTCAACGCACCGGCTCTT
TGATTGACGACGTAAAGATCCGCGGATAAGTCGCCGACCGGAGGGATGCGCCGTACGGATAGCCAGCCACGACTGTTCATAAATCGATAAAGCTTGAGCG
ATCGGTCGGAAGCGGCAGCGACCGTGTCAAATGGCACGGCTCGGTTCTGAAAAGCGAGCCGGGCACCGTTGAGATTGCCGACCAACTCTCGGGGTGTAGC
CAGACCTTCCGCACAGTGCAACTTTAGTGTTCGATGATATTGCTTCAAAGGGTTATTTGAAGCGGCATATCCACCAGGTGTGTAGAACGCCTGCCAGCGG
GAAAACCGGGTCGAGTTTACCCAAAACCTTTTCACATGATCTGTGAGTTTACGTACTCAAGAACCGAGACGAAACCTGTCCCATCGCTCCAAAACGCAGG
CCTTTACAGCAGGAAATGCATCTTGAGTCGCATAATGCATGTCGTACAAATCCGCAAACACAACTCGTGTATCTTCCGTGCTCGCACGGAATGTGCGAGC
ATGTTTCCACACATTCTGTGTCACGTGAAACCAGCACATCAAAATGGTTGTACCTGGAAGCTCGGCCGAACAGGCGTTGAACTGCGCATTGCAAGCATCT
GACATCATGAACTGCGGCGAAATGGCATCCAAACACACGCGCTTCATGAAGCTGATGCACCATCCGACGTCAATTGCGCGCTCTTGAGATGTGCAAAAGT
AAGCGAGAAAAAAGAACTGGCCGCACCGATCTGAGTATCCAAAGGCGAACACGTTGTAGCCGTTGATCACCATACTGTGGGTGCTGTCAACGTGAAATAT
CGTAGTGCAATCCGACCGATTCTGCACTGCAATATAGTCACGGACGAGACGTAGACGCGTCATGCCAACACGATAAGGAGAATCCTCAGATCCGTCTCCG
AGATGTGAGGCGCTGCTCGCGGTACCGGGCAGATCACTTTGTTGCGCGTCGCACAGTATCATCATGTCGCGCTCAGGCAGCGACTGTAGATCCAGCTGAT
CGTACAGATTTCCATCGCAAAGCTGAATCATCGACGCCATGGAATCTCGTGGGTTATCCCACCTCCAGTTTTTGACAAAATCAGTCACTTGAGTGTCTTT
CGGAGCAGGACCTGTGATCACACCTGCCTCGACCATGGCGCTGAGAGTTGTAAACAACTTGGTGGCTGTTGTTTTGACTCAACTACTTAGCTTCTCGTTA
ATAAACGTCTTCATTGCAGGGGAAATCTTGCGCTCTTTGGAGTTGGCGGATAGGTTCTGTGCATGACATGCTCGCCTTGATGAAACACCTCACAGGTGCT
AGAGGACAGACAGATCTTGAACTTGTCCCGACACGGACATGATGCCGTCTCTGTCGATGTAGCGTCGTCGTCAGGGGCAGTGAGTCTGGCACGACACCGC
TGAGACCGGCACAGTACCATTTGAGACCGCATTTGATGCATGCAGCAAGCTAGATCGAAGTCCTTATCAAATTTATGATCCACAGAACATCCCCACTGGA
TTACTCTTGTCGATACAGTGAGTTGGCAGTGAGTCCCGAAAGGACTGTAGTGCCCCCGACACTGTTGATCTCCATATCTTGGTCCATGTTGGTCGGCGAC
GCCTTGGCTGGGCCTCCTCGCCATCCGATTCAAACGTCTGTAGCTGCAGAATTCCATCAGAAATGGATAGCAGCTCGCTATCGCGCTCGGACATTGTTAG
TGTTCACTTTTCGGCAATGCACGCAGGAGGCGAACAGAGAAGCATATATTGAGCTAAACAGCTACAAAAGTCACTTCAACATCTTGAAGTGCTTTTTTGG
TGTTTGTCTATTTTTTGCTGGTGGCGCC