Description :
From Genome Similarity Track
Location :
Scaffold_421:5812- 12540
Sequence
6728 bases(100 bases per row)
GGTCGGCTACACCCTAGAAGGTCTCAACTCTCAAAATCCCGTCACAGGAGGCGGCAAGTTTGACGCAAAGTAACTACAAAGGCAAGAGAACTCACCCGCA
AGGCAACCCTACGGCCACATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGGAGGTTT
TCCACTGCTGCTCCATCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACGCTTTAAAAGTTACCGAGAGAGCAAGATCCCGCCCTAC
CGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGCTGGATCCGG
CAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGGTCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTC
AAGTGAAGATTGAGCCACGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAG
GAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCTAGAAGAGAAACCTCTCTATCCCCCGCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGT
CAAGATCCGCTAACAAAACAATGGAAAGTGAAGGCGAAACGGTATGCATTTGAAGATTCACCGGTTAAGCCAACACCGTACCTAAACTCAAGCCCGCTAG
TCGAAGAAACGAGAAAGAAGACGAAAACGAGTATGACTACGCAGAAAAAGATGCAAGCTCCAGAGTCGGAAAAAGACCAAGCTGGATCCAGGTCGAGCCG
GTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTCTACGCGATTTTCTGCATCAAGATCCTGTCATGCGGATCCTGAATCAACGACAGATCGAA
GATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACACGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTG
GTGTGTTCGACGCAGAGGATATCTTCGAACTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAG
GTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAA
CCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGTCCCTGTGAACGTGAAGGCTCGGGATC
CAGTACGCCCTACGCGTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCG
CCTCACGGATCCGGTCTCGCCACTGGACCAGACAGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGT
TTCCTGGCCGAACAGGGTATGAGAGCGCCCGTATCACAAGTGCCAGTGCTCCACGAACATGGAGCACGAGATGTGGAGATGGAGTCAGTGGAGGGAGACA
ACTCCCATGATGAGTTCGACCCAGATGATCGGGAGGCCCATCCCCGTCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCAGGTGGATCGTCCATGATC
CAGAGGGTACGGATCTCAGCCATATCGGATCTAAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAGGTCAAGTCGG
CCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAATTGGTATCGGCAGCTGGGCAGATC
CACTAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTTCCAGACCCAGTACTGCGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAG
ATCGGATGAATCCCCGCTAGAATACCTACATCGACTAAATGTGGCCGGTTTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAA
CACGTGGATCATTTCATCGAGACATTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGACCTCCCGACGCAGACGAGCTTGAGGAAGTGCTGC
GGGCGGTGGATCGCGCGAAACACCGCCAGAAGAAGAAGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGT
CCACCAAGTCACGGCGCTCGACTCAGGAACTGAGTCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAAC
GATCGAACGGCGAAGACCGGAGACAGCTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGCAC
AAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGA
TCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCA
GCCAAGCACAGAGGGATGTTGCCAGAAGTGGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATGCGGTACGAGCCGAGCTTTCTAGGTAATG
CATTTATGCATTTGTGAACAAGACGTCACTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGTCAAG
ATCTCTAGTTTGCGCCAAGTGGATGAGTTTTCCAGATCCAAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAAGCACGTGGTTATTGGGAGAAACGCC
AACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCAAGTCACTGGATCCCGTGGATCTGAGGATGTTGGATC
CATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAG
AAAGAAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGACACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAG
ATTGTGTTGGGATTAGTGAAGGCGTATACCGTACGAACGGGAGAACGCGAATCAAGATCACGTTGGCAGGTTGTTTGTTATACTGGTTTGATATTTGGGT
AGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCAAGGTACCAGCCGGAGTGAGGTTGGATTTGGCGGATGGGACACTTTGTTTCCCTGAC
GAGATGCGGATCCAGCTCAGCTGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATACGGGCGGATAAGACAACCTGGATCGAGCCCGGGGAAACCT
GGGAACTGCCAGATCGGTTAAAGTGGGTGGAACATGATAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATC
ACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGGCCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGA
CCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCC
CGGCGGGGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAAGGATCGTCGGGTTGAGATCCAAGCAATGGAGGT
TGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCCTAGATAACGCAGGGTCGGTGAATGAAGAATAGCAGAGGGCTAAAGCCGGACCGCCAGATCCC
GCTGATCCACCAGTGGGTCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTCAAACAAGAACCGTCGTGTTTACACT
CGCTAGATAATCAAGTCGATCCAACTGGTGGCCTCCCCGGTACCAGGGTACTTGATTCCACGAAGACAGAAGGACTGACAGGTGAAAGAGGGTCGCGGTG
CTTGGATCCAATAGTGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCTCGGAGAAGGCCTGGCG
GTGATCTCGCGAGGGTACCCTGTGAACCACGGAAGAAGTCCCGCATTGATGATATCCTCAGTGGAATCTCGGGGGCGAATGAATCCTGCTGAAGTGGATC
GTCTGCGTCAGAAAATTTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCGCTACCGCCTGCTGCTCGCGGAGTCAAATGTGCCATCGATGTCGG
CGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATC
AGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTC
TGACTCGATTGATGGTGTATCCGATGCATCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTT
TTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAAC
GCACCCCAGATCTACCAACGTCTAATCGATAACGCTCTCTATGGATACACCCGAATACCGGAACCCAAAAGGGGTGGATCCGGGGAGGATCATACGGAAG
TAGATTCATCCGAAGCAGGAGAGCCAGGGGATCCTGGGATCCCGTCTGTGTTAGGACTAAGATCTTATATCGACGACATTCTAATCCCGGCGAAATCGTG
GGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGCGCTATTGGGGGATGCGCAAGGTG
GATTACTTAGGCCATCGAGTTTCCAAGGAGAGATTGGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGA
TGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGAATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTCGC
TGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACAAAGGAATCCAAGTGGTACGACGCCAGAAGAG
GACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGT
GGATCCGAGCTCAACACGCATTCGTGGAACTGAGGAACAGGATCGCGACCACGCCTATTCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTTATAGT
TTATGCCAGCGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAGGGGATCTGTCATCCATTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAA
CTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTATTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCC
GACACTCTACACTAGCCTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTATTCTCGCCTTGGACGCTGGAGATTGTGAA
ATGTTCGAAAGGGGAAGACGAGATCCTGGTAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAAAAA
GAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGCAGACGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGCGTACGACGCGGAG
GCGGGGCGTACAGTGCGATACTGTGGAGACTACCTGGATGGGAAGTACTACGGGCCAGATCCACTTATGCGGAAGGCCTCACCGTCAACGAAGCGGAGTA
TAACGGGCTACTGCTGGGTTTGGATCTACTAAAGGGACCAGATCCGAAAAGGCTGGTGATTTGTGGCGATTCAATTTGGGGGATCAGACAGGTGCGAGAT
GAGATTGACTGCAAGGCCCCCGGGCCCTAACACTGTTACCACAGAGAGTGATGATCTCACCTGCGTGGTTGGAGAAATCGCAAGTTCCTTCTCCTCATGG
GAGAGTAGGATGGAAGTGCCGATAGCTT