Description :
From Genome Similarity Track
Location :
contig_163:5812- 7691
Transcript NameFunction/comments
g13961.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g13962.t1BAP69084.1 RxLR effector candidate protein, partial [Hyaloperonospora arabidopsidis Emoy2

Sequence
1879 bases(100 bases per row)
CTGAAAGTGTTCGGTTGCCACGCGTATGTGCACGTGCCGAAGGCGAAGCGCACCAAGTTCGACGCTCGGTCGGTGCGCTGTCGGTTCCTGGGGTACTCGG
AGCACGAGAAAGCGTATCGATTCGAAGAACTGGAGAGCAGTCGCGTGCTGGTGAGCCGCGACGCGCAGTTCATGGAAGACGTCTTCGACAGTGGGAGACG
CGACTACCATCAGAGGGAGGTGGTGGTCATTCAAGATGAAGAGACGACGGATCAAGATTCGTCGCAGTCGGATGAAGACGACAACGAAGAAGAGGAAGAA
GAGGAAGCTGCGCGGGACGAAGACTTCGGGCCCGGCAACAAGCGACACCCGCGGACGCAGTCGCTGGAGGAAGTCACGGAGGTTCCAAGTGCCAAGCGGT
ATGCGTCGCAGAGTCGACACCAGACTCTGGACGAGATGTCGGCTGCGGCTCAAGAAAGTCAAGACTTCGAAGCTGCGTACGTCGTGGATTCAGTGGGAGA
AATGCCGACCACGTTCAAGTCGGCGATGGAATCCAGCGACGCAGTCAAGTGGAAGGAGGCGTGCGACTCGGAGTGTGACTCGCTGCTCAAGAACGACACG
TGGGATGTCGTACCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTTCGCGTGAAGGAGAACCAAGCTGGAGAGATTGAGCGGTTCAAGG
CGCGACTGGTGGCCAAGGGGTTTTCGCAGAAGTACGGCATCGACTACGACGAGACCTTCGCACCAGTGGCCAAGTTCACGTCCATCCGGATCGTACTGAG
TCTGGCTGCCAAGTATGGTCTCAAGCTGCACCAGATGGATGTCAAGACTGCGTTCCTCAACGGTGTGCTGGACGAAGACATCTACATGGCACAGCCGGAT
GGCTATGTGGACGAAGACCACCCGGACCACGTGTGCAAGCTCAAGCGGTCGCTGTACGGACTGAAGCAGTCGCCGCGCATGTGGAACCAGACCATCGACG
ACTTCATGCTCAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCGTCTACCTGAAGCGTGACGGCCAAGACATGATCTTCGTGGCGCTCTACGTTGA
CGACTTGGTCCTCGCTAGCAGCAACGACGAGCTGTTGGAATCGACCAAGCACGCGTTGAGCAAGCGGTTTGAGATGACGGACCTCGGCGAGCTGGAGTAC
TTCCTCGGGATGGAGATCAAGAACGACCCGGCTCCGGAAAAGTGACGGTGCGGCAGACCAAGTTTCTCAAGTCCATCCTGACCAAGTTCGGCATGCAAGA
CAGCAAGCCTGTGAAGACGCCGCAAGACCCCGGACTCAAGCTGACCAAGAACATGTGTGAGGGTGGCTGCCAGCATGAAGACACGATGAAGAACGTGCCG
TATCGGAGTGCCGTCGGTGCTCTCATGTACTTGATGGTGGCAACGCGTCCGGACCTGGCTGCTGCAGTGGGAGTGCTGAGCCAGTTCTCTGCCGACCCGT
GTCCGACGCATTGGCAAGCCCTCAAGCGTGTGCTGCGGTACCTCCAAGCGACGCCTACGCATGGACTCGAGTTCTCACGGGAAGACAGCCTTGGTATGTG
CGGCTATTCGGATGCGGACTGGGCCGGCGACATCGAGTCAAGACGGAGCACAAGCGGCTACGCGTTCATGATGAACGGCGGATGCATCAGCTGGAGGAGC
AAGAAGCAGCGGACGGTGGCGCTGTCTTCAACGGAAGCAGAGTACATGGCGCTATCGGAGGCGACACAAGAGGCAGTGTGGCTCAAGGTGTTCCTGTGCG
AGCTCGGCGAGATGGCAAGCGATGAAGCGGTCAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCC