Description :
From Genome Similarity Track
Location :
Scaffold_6:581177- 582470
Transcript NameFunction/comments
Sapdi_VS20SDRG_02697hypothetical protein

Sequence
1293 bases(100 bases per row)
CACCGTGCGGAGGTGCGTCGGGAGACCCTCGATCGTGTGGTTGGAGATGTTGCGCATGAGCGTCGTCTTGCCGACACCGTTCTTGCCTACGAGACCGTAG
CGGTGGCCGCGCGTGAGGCGGAGGCGCGCGTTGCGGAGCAGAATCTTGCCACCGTACGCGAGCGAAAAGTCGATGTCGCACACGTCGTTCGGGTCCGTCG
AGACGACGCGATCGTCGCCAAGACCGCCACCGGCCTTACGCAGCGCCTTGCACACGCGGTCGGCGTCTTCGTCGTGAAGGTGCGCCGAAAGGTACGGCAG
CACAAAGCCGCGCCACTCCTTGCCACGGTTGTGCGTCACAAGCTCCGCGCACACGTCCGTGATGTACGTGAGCGTGAACTCGGTGAGGCCCGGGTGCGTC
GCGATTTCGAGCGCTTCGTGGAGACCGGCGAGGAGGTTTTGCTGGAGCTGCTGGCGGATCGCGGCCGGATCTTCTTCATCCGAGCCTTCGCCGGCGGCGC
GCTTGAGGCACGCACGCGCGTCCGAAGCCACTTCCGCGACTTCCTGGTCAGCGATACGCTCGATGACCGTGTCGAGCTGCGGCAAAAGCAGCGGCACAAA
GGGAGCGACGTCGCTCGGGCGAGAGACGAGGCGGCACATGCTGTCAATAATACGCGAGGCCTTGCGACGGAGCGCCGACGAGTTGGTCGACGTGTCACGG
AGCGCCTTGTTGAGGAGCGGCGCAATGAGCGAGAGCGTCGCGGCGTCGACGTTGGCCACGAACGTCGTCGCGAGAAGGGCGTCGATGGTCGCAAGCGTCT
TCTCGGGGTGCGCAATCACATCGACGAGCGTCGGGACGAGCGGGAGCACATCGTCGTTGCCGATCGTCGAGCAGGCAGCCGTGAGCGCCGAAAGCGCGGC
CTGCTGGACCTGCGTCTTGGTATCCCACACGACCTCCGAGACCTTGGGGATGACTTCCGGGAGCGAGCACGAGACTTCCGTCGGCGCACGCGGCGCAAAG
TTGCGGAGGAGGTCGAGGGCAGCGACCTTGCACTGCCACTGGCGAAGCTCCAAGCAGACAAAGATCTGCGAGAGGAACGTGCGCGTCGCGAGCGGGTTCA
CGAGGTCGAGGAGCGAGTGCGTGAGGCGCACCGCGGCGTCGCGGACGTTGGGCTCCTTGTCGGCATGGCGCTCCATGATCGAGACGAGATCTTCGACGAC
AATCGGCTCGATAGCGGACGAGACAGCGTCGCAGCGACCCATGGCGGTGAACGTGAGAAGCGCACCTTCGCGCGAGTCCACGGCCTTGCTCTT